FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636490_at:

>probe:Drosophila_2:1636490_at:137:319; Interrogation_Position=151; Antisense; GCCGTCGACTATGTGATCATCCATC
>probe:Drosophila_2:1636490_at:353:13; Interrogation_Position=235; Antisense; ATTCAGTCGGATCACAAGGGTCGCC
>probe:Drosophila_2:1636490_at:342:223; Interrogation_Position=250; Antisense; AAGGGTCGCCGCAATTTCAGCGATA
>probe:Drosophila_2:1636490_at:420:659; Interrogation_Position=282; Antisense; TAACTTTATCGTGGCCGGTGATGGC
>probe:Drosophila_2:1636490_at:492:217; Interrogation_Position=29; Antisense; CAATTAGTTTTGTGGCCGCTTTAGT
>probe:Drosophila_2:1636490_at:624:517; Interrogation_Position=323; Antisense; GTGGTTTCGGGCTCCAGGGATCACA
>probe:Drosophila_2:1636490_at:621:343; Interrogation_Position=371; Antisense; GCATTGGCATCGTCTTCATTGGCAA
>probe:Drosophila_2:1636490_at:234:447; Interrogation_Position=423; Antisense; GATGCTCCAGAACGCCAAGGATCTA
>probe:Drosophila_2:1636490_at:534:223; Interrogation_Position=439; Antisense; AAGGATCTAATCGAGCTGGCCAAGC
>probe:Drosophila_2:1636490_at:603:437; Interrogation_Position=481; Antisense; GATAACTACACGCTGTTCGGTCATC
>probe:Drosophila_2:1636490_at:651:705; Interrogation_Position=49; Antisense; TTAGTGCTTTGCTGCTTAGCTCTAT
>probe:Drosophila_2:1636490_at:68:321; Interrogation_Position=527; Antisense; GCCCAGGTGATGCTCTGTACAACGA
>probe:Drosophila_2:1636490_at:590:427; Interrogation_Position=550; Antisense; GAGATCAAGACGTGGCCGCACTGGA
>probe:Drosophila_2:1636490_at:459:233; Interrogation_Position=79; Antisense; AATGCCCTGCAGATTGAACCACGCA

Paste this into a BLAST search page for me
GCCGTCGACTATGTGATCATCCATCATTCAGTCGGATCACAAGGGTCGCCAAGGGTCGCCGCAATTTCAGCGATATAACTTTATCGTGGCCGGTGATGGCCAATTAGTTTTGTGGCCGCTTTAGTGTGGTTTCGGGCTCCAGGGATCACAGCATTGGCATCGTCTTCATTGGCAAGATGCTCCAGAACGCCAAGGATCTAAAGGATCTAATCGAGCTGGCCAAGCGATAACTACACGCTGTTCGGTCATCTTAGTGCTTTGCTGCTTAGCTCTATGCCCAGGTGATGCTCTGTACAACGAGAGATCAAGACGTGGCCGCACTGGAAATGCCCTGCAGATTGAACCACGCA

Full Affymetrix probeset data:

Annotations for 1636490_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720