FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636491_at:

>probe:Drosophila_2:1636491_at:449:471; Interrogation_Position=460; Antisense; GTTCGCCCAAGATGTGGTCCCTGGA
>probe:Drosophila_2:1636491_at:401:443; Interrogation_Position=490; Antisense; GATGTACTGCCAACTGTGAGCCCGG
>probe:Drosophila_2:1636491_at:5:619; Interrogation_Position=516; Antisense; TGCATCATCATTGGCGAGCGGACCA
>probe:Drosophila_2:1636491_at:421:651; Interrogation_Position=581; Antisense; TAATACGGGTCGAGGAGCTGCATCC
>probe:Drosophila_2:1636491_at:537:693; Interrogation_Position=666; Antisense; TTTCTGGTCAACATGTCGCTGGTCC
>probe:Drosophila_2:1636491_at:79:253; Interrogation_Position=722; Antisense; CAAGCTGCAATAGGCCTTCGGGTCA
>probe:Drosophila_2:1636491_at:101:707; Interrogation_Position=738; Antisense; TTCGGGTCACCTCACAGAATTTACG
>probe:Drosophila_2:1636491_at:107:109; Interrogation_Position=753; Antisense; AGAATTTACGGACACTCAGCGCTCT
>probe:Drosophila_2:1636491_at:467:171; Interrogation_Position=779; Antisense; AAAGATGCTCCACACTGAACTCAAC
>probe:Drosophila_2:1636491_at:16:385; Interrogation_Position=795; Antisense; GAACTCAACTCCACTAAATGCCAAA
>probe:Drosophila_2:1636491_at:535:191; Interrogation_Position=828; Antisense; AACTTTAGTTCGATCTCTTCTGCAA
>probe:Drosophila_2:1636491_at:369:25; Interrogation_Position=858; Antisense; ATAGGCCATCATGTTGCCGGGTGAT
>probe:Drosophila_2:1636491_at:433:109; Interrogation_Position=884; Antisense; AGAAGAGCCACAGCGAGTTCACACC
>probe:Drosophila_2:1636491_at:709:1; Interrogation_Position=930; Antisense; ATTGGACCCTTGTTTCTGTAGGCTA

Paste this into a BLAST search page for me
GTTCGCCCAAGATGTGGTCCCTGGAGATGTACTGCCAACTGTGAGCCCGGTGCATCATCATTGGCGAGCGGACCATAATACGGGTCGAGGAGCTGCATCCTTTCTGGTCAACATGTCGCTGGTCCCAAGCTGCAATAGGCCTTCGGGTCATTCGGGTCACCTCACAGAATTTACGAGAATTTACGGACACTCAGCGCTCTAAAGATGCTCCACACTGAACTCAACGAACTCAACTCCACTAAATGCCAAAAACTTTAGTTCGATCTCTTCTGCAAATAGGCCATCATGTTGCCGGGTGATAGAAGAGCCACAGCGAGTTCACACCATTGGACCCTTGTTTCTGTAGGCTA

Full Affymetrix probeset data:

Annotations for 1636491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720