Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636492_at:

>probe:Drosophila_2:1636492_at:314:683; Interrogation_Position=123; Antisense; TATGCCCTCGCCCTGAATGAGAATG
>probe:Drosophila_2:1636492_at:520:357; Interrogation_Position=14; Antisense; GCAAAGATCCAAGCACAACCGAAGA
>probe:Drosophila_2:1636492_at:407:109; Interrogation_Position=142; Antisense; AGAATGCAGCTGCTCTCGAGGATCT
>probe:Drosophila_2:1636492_at:637:325; Interrogation_Position=203; Antisense; GCGAGATGCTCGTGGTTAAGGTCAT
>probe:Drosophila_2:1636492_at:457:707; Interrogation_Position=218; Antisense; TTAAGGTCATGGCAACTACGGACAT
>probe:Drosophila_2:1636492_at:272:557; Interrogation_Position=303; Antisense; GGACATTATGGTCGCTAGTGTATTT
>probe:Drosophila_2:1636492_at:471:663; Interrogation_Position=337; Antisense; TAAACTAACCCTGATGACAACACAT
>probe:Drosophila_2:1636492_at:601:395; Interrogation_Position=37; Antisense; GAAATCTCTCCACGAAATCACTGAC
>probe:Drosophila_2:1636492_at:642:217; Interrogation_Position=389; Antisense; AAGTAGGTTCTCTTCAAACTGCAAT
>probe:Drosophila_2:1636492_at:160:255; Interrogation_Position=403; Antisense; CAAACTGCAATACGATGTCTTTAAT
>probe:Drosophila_2:1636492_at:508:535; Interrogation_Position=495; Antisense; GGTGCCAAAAGAACACACACATTGT
>probe:Drosophila_2:1636492_at:92:35; Interrogation_Position=53; Antisense; ATCACTGACCCGAAGTATCTGCAAG
>probe:Drosophila_2:1636492_at:545:615; Interrogation_Position=72; Antisense; TGCAAGATGCGTCTAATCCTTCTGT
>probe:Drosophila_2:1636492_at:707:655; Interrogation_Position=85; Antisense; TAATCCTTCTGTCCATCGTTGGCCT

Paste this into a BLAST search page for me
TATGCCCTCGCCCTGAATGAGAATGGCAAAGATCCAAGCACAACCGAAGAAGAATGCAGCTGCTCTCGAGGATCTGCGAGATGCTCGTGGTTAAGGTCATTTAAGGTCATGGCAACTACGGACATGGACATTATGGTCGCTAGTGTATTTTAAACTAACCCTGATGACAACACATGAAATCTCTCCACGAAATCACTGACAAGTAGGTTCTCTTCAAACTGCAATCAAACTGCAATACGATGTCTTTAATGGTGCCAAAAGAACACACACATTGTATCACTGACCCGAAGTATCTGCAAGTGCAAGATGCGTCTAATCCTTCTGTTAATCCTTCTGTCCATCGTTGGCCT

Full Affymetrix probeset data:

Annotations for 1636492_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime