Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636496_at:

>probe:Drosophila_2:1636496_at:603:211; Interrogation_Position=6520; Antisense; AAGAAACGTGTAATGCTGCAATCAA
>probe:Drosophila_2:1636496_at:118:35; Interrogation_Position=6540; Antisense; ATCAAACAGAGATGCGAGGCCATGT
>probe:Drosophila_2:1636496_at:531:293; Interrogation_Position=6554; Antisense; CGAGGCCATGTAATAGCGCAAAAAA
>probe:Drosophila_2:1636496_at:300:29; Interrogation_Position=6601; Antisense; ATACGTATATTCGAGTTATTGGCCG
>probe:Drosophila_2:1636496_at:106:91; Interrogation_Position=6614; Antisense; AGTTATTGGCCGATACGTCGAGCAT
>probe:Drosophila_2:1636496_at:171:319; Interrogation_Position=6622; Antisense; GCCGATACGTCGAGCATATGATGAT
>probe:Drosophila_2:1636496_at:376:723; Interrogation_Position=6646; Antisense; TTGCAGTCAGATAAGAGCGATCGGC
>probe:Drosophila_2:1636496_at:588:417; Interrogation_Position=6660; Antisense; GAGCGATCGGCAAACGATTGCATTA
>probe:Drosophila_2:1636496_at:654:675; Interrogation_Position=6710; Antisense; TAGCGTTTAGATTCACACACACACA
>probe:Drosophila_2:1636496_at:317:535; Interrogation_Position=6745; Antisense; GGAAAATACCTGCAACGACGTTCTG
>probe:Drosophila_2:1636496_at:543:199; Interrogation_Position=6758; Antisense; AACGACGTTCTGTGCAGCAGCCAAG
>probe:Drosophila_2:1636496_at:458:113; Interrogation_Position=6773; Antisense; AGCAGCCAAGGTGGAAAGCCAACAA
>probe:Drosophila_2:1636496_at:651:125; Interrogation_Position=6833; Antisense; ACCAACCAACCCTATAGCTAACAAG
>probe:Drosophila_2:1636496_at:238:725; Interrogation_Position=6988; Antisense; TTGATCATTTTTAAGTCGAGAACAG

Paste this into a BLAST search page for me
AAGAAACGTGTAATGCTGCAATCAAATCAAACAGAGATGCGAGGCCATGTCGAGGCCATGTAATAGCGCAAAAAAATACGTATATTCGAGTTATTGGCCGAGTTATTGGCCGATACGTCGAGCATGCCGATACGTCGAGCATATGATGATTTGCAGTCAGATAAGAGCGATCGGCGAGCGATCGGCAAACGATTGCATTATAGCGTTTAGATTCACACACACACAGGAAAATACCTGCAACGACGTTCTGAACGACGTTCTGTGCAGCAGCCAAGAGCAGCCAAGGTGGAAAGCCAACAAACCAACCAACCCTATAGCTAACAAGTTGATCATTTTTAAGTCGAGAACAG

Full Affymetrix probeset data:

Annotations for 1636496_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime