FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636498_at:

>probe:Drosophila_2:1636498_at:113:459; Interrogation_Position=442; Antisense; GATTTCGATTTTATGGCCGCCACGG
>probe:Drosophila_2:1636498_at:240:351; Interrogation_Position=472; Antisense; GCAGTTCCCTGTGCACTAATGTTAA
>probe:Drosophila_2:1636498_at:63:45; Interrogation_Position=527; Antisense; ATCGCTCCCAGGTCAGTTTAATGCT
>probe:Drosophila_2:1636498_at:666:655; Interrogation_Position=545; Antisense; TAATGCTGGTCTTCTTCGACGGTGA
>probe:Drosophila_2:1636498_at:345:435; Interrogation_Position=595; Antisense; GAGGATTCGCCATATGGTTCCAGAC
>probe:Drosophila_2:1636498_at:644:31; Interrogation_Position=656; Antisense; ATAAGATAGACCTCTTCGTGCTGCC
>probe:Drosophila_2:1636498_at:622:717; Interrogation_Position=670; Antisense; TTCGTGCTGCCGGATCTAATTGGAG
>probe:Drosophila_2:1636498_at:89:13; Interrogation_Position=721; Antisense; ATTCTCGATACATCAGGCTGGTTCC
>probe:Drosophila_2:1636498_at:525:541; Interrogation_Position=740; Antisense; GGTTCCACCGACTTGTACAGCTGGA
>probe:Drosophila_2:1636498_at:549:611; Interrogation_Position=767; Antisense; TGAAGCTATTCCAGGCGGGCATTGT
>probe:Drosophila_2:1636498_at:596:523; Interrogation_Position=783; Antisense; GGGCATTGTGCGCTCAGAACGTCCA
>probe:Drosophila_2:1636498_at:560:443; Interrogation_Position=832; Antisense; GATGTAGATGATGACCACCTGCCTT
>probe:Drosophila_2:1636498_at:66:361; Interrogation_Position=866; Antisense; GCAACGTTCCGGTCATACATCTAAT
>probe:Drosophila_2:1636498_at:219:251; Interrogation_Position=964; Antisense; CAAGTGGGTCTAGTTCTGCGAATGT

Paste this into a BLAST search page for me
GATTTCGATTTTATGGCCGCCACGGGCAGTTCCCTGTGCACTAATGTTAAATCGCTCCCAGGTCAGTTTAATGCTTAATGCTGGTCTTCTTCGACGGTGAGAGGATTCGCCATATGGTTCCAGACATAAGATAGACCTCTTCGTGCTGCCTTCGTGCTGCCGGATCTAATTGGAGATTCTCGATACATCAGGCTGGTTCCGGTTCCACCGACTTGTACAGCTGGATGAAGCTATTCCAGGCGGGCATTGTGGGCATTGTGCGCTCAGAACGTCCAGATGTAGATGATGACCACCTGCCTTGCAACGTTCCGGTCATACATCTAATCAAGTGGGTCTAGTTCTGCGAATGT

Full Affymetrix probeset data:

Annotations for 1636498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720