Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636500_at:

>probe:Drosophila_2:1636500_at:308:139; Interrogation_Position=1041; Antisense; ACGGTCACGATCATACGGCCGATGA
>probe:Drosophila_2:1636500_at:556:443; Interrogation_Position=1061; Antisense; GATGATATGCCAGATGCGCCACCTG
>probe:Drosophila_2:1636500_at:672:125; Interrogation_Position=1092; Antisense; AGCCGGTGATCCCAATGCTGCAGGA
>probe:Drosophila_2:1636500_at:692:181; Interrogation_Position=1122; Antisense; AAAACAGCGAACTTATGGCCGGTGA
>probe:Drosophila_2:1636500_at:89:681; Interrogation_Position=1135; Antisense; TATGGCCGGTGAGTCTAATCTAAAG
>probe:Drosophila_2:1636500_at:77:261; Interrogation_Position=689; Antisense; CAGCCTCCCCGTGTACAGAGGAAAA
>probe:Drosophila_2:1636500_at:450:705; Interrogation_Position=740; Antisense; TTACGCCAGTTTGGTGCCGTCGAAA
>probe:Drosophila_2:1636500_at:340:727; Interrogation_Position=771; Antisense; TTGTCGCTGTTGAATCAGCCGGCTG
>probe:Drosophila_2:1636500_at:15:127; Interrogation_Position=787; Antisense; AGCCGGCTGCTGTGACGTCAGAGAA
>probe:Drosophila_2:1636500_at:608:627; Interrogation_Position=818; Antisense; TGCCATCACGCCAACGGTAAATACG
>probe:Drosophila_2:1636500_at:67:567; Interrogation_Position=854; Antisense; GGCACTTGGAGCCATTTCGAGCATA
>probe:Drosophila_2:1636500_at:305:17; Interrogation_Position=887; Antisense; ATTTATGCTCTATATCGTCACCTGG
>probe:Drosophila_2:1636500_at:686:581; Interrogation_Position=919; Antisense; TGGCCCGCTCGAACAAGTGCAACAG
>probe:Drosophila_2:1636500_at:486:621; Interrogation_Position=981; Antisense; TGCGCTTCGAGATGCTCTTTGCCGA

Paste this into a BLAST search page for me
ACGGTCACGATCATACGGCCGATGAGATGATATGCCAGATGCGCCACCTGAGCCGGTGATCCCAATGCTGCAGGAAAAACAGCGAACTTATGGCCGGTGATATGGCCGGTGAGTCTAATCTAAAGCAGCCTCCCCGTGTACAGAGGAAAATTACGCCAGTTTGGTGCCGTCGAAATTGTCGCTGTTGAATCAGCCGGCTGAGCCGGCTGCTGTGACGTCAGAGAATGCCATCACGCCAACGGTAAATACGGGCACTTGGAGCCATTTCGAGCATAATTTATGCTCTATATCGTCACCTGGTGGCCCGCTCGAACAAGTGCAACAGTGCGCTTCGAGATGCTCTTTGCCGA

Full Affymetrix probeset data:

Annotations for 1636500_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime