FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636501_at:

>probe:Drosophila_2:1636501_at:650:251; Interrogation_Position=2498; Antisense; CAAAGTCCGGTGAGGATCAATCCAA
>probe:Drosophila_2:1636501_at:702:375; Interrogation_Position=2535; Antisense; GAAGAAGCCCAGCTCTGAGGAGAAA
>probe:Drosophila_2:1636501_at:559:197; Interrogation_Position=2674; Antisense; AACGATGGCGACGACGAGCCGAGCT
>probe:Drosophila_2:1636501_at:412:293; Interrogation_Position=2763; Antisense; CGAGGACGACGTCTATCCGGATGTC
>probe:Drosophila_2:1636501_at:110:47; Interrogation_Position=2777; Antisense; ATCCGGATGTCCGTGATTGCCGCAA
>probe:Drosophila_2:1636501_at:356:513; Interrogation_Position=2789; Antisense; GTGATTGCCGCAAATACTACCGTTG
>probe:Drosophila_2:1636501_at:68:673; Interrogation_Position=2806; Antisense; TACCGTTGCGAGGTCAAGAAGTCCG
>probe:Drosophila_2:1636501_at:60:109; Interrogation_Position=2822; Antisense; AGAAGTCCGGCAAGCATAAGTTCGC
>probe:Drosophila_2:1636501_at:392:225; Interrogation_Position=2866; Antisense; AAGGAGCGATTCGACTGGCTTACCC
>probe:Drosophila_2:1636501_at:445:595; Interrogation_Position=2896; Antisense; TGTGTGCCCAAGGATGAGGCCCGTT
>probe:Drosophila_2:1636501_at:610:49; Interrogation_Position=2909; Antisense; ATGAGGCCCGTTGTCTCGAGAAATA
>probe:Drosophila_2:1636501_at:538:529; Interrogation_Position=2944; Antisense; GGGATGCCACAATCAACTGCACTTA
>probe:Drosophila_2:1636501_at:420:605; Interrogation_Position=2980; Antisense; TGATATTCTATCTCCATTTCCTGGG
>probe:Drosophila_2:1636501_at:631:627; Interrogation_Position=2998; Antisense; TCCTGGGTCCTATCTAATTTATTGC

Paste this into a BLAST search page for me
CAAAGTCCGGTGAGGATCAATCCAAGAAGAAGCCCAGCTCTGAGGAGAAAAACGATGGCGACGACGAGCCGAGCTCGAGGACGACGTCTATCCGGATGTCATCCGGATGTCCGTGATTGCCGCAAGTGATTGCCGCAAATACTACCGTTGTACCGTTGCGAGGTCAAGAAGTCCGAGAAGTCCGGCAAGCATAAGTTCGCAAGGAGCGATTCGACTGGCTTACCCTGTGTGCCCAAGGATGAGGCCCGTTATGAGGCCCGTTGTCTCGAGAAATAGGGATGCCACAATCAACTGCACTTATGATATTCTATCTCCATTTCCTGGGTCCTGGGTCCTATCTAATTTATTGC

Full Affymetrix probeset data:

Annotations for 1636501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720