FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636502_at:

>probe:Drosophila_2:1636502_at:689:335; Interrogation_Position=1371; Antisense; GCTGCCTACACACTGATAGCCAAGA
>probe:Drosophila_2:1636502_at:79:99; Interrogation_Position=1393; Antisense; AGAGTTTCTACGAGAGCCTGGTCCG
>probe:Drosophila_2:1636502_at:266:255; Interrogation_Position=1431; Antisense; CACCGCGTTAACTTCTTCGAGTACG
>probe:Drosophila_2:1636502_at:650:385; Interrogation_Position=1455; Antisense; GAAAAGCCCGGCTGGACGTACCATG
>probe:Drosophila_2:1636502_at:332:595; Interrogation_Position=1489; Antisense; TGTGGTACTACCTGCCAGAGGCAAT
>probe:Drosophila_2:1636502_at:661:603; Interrogation_Position=1531; Antisense; TGATCGGCTCTTCGAACTTTGGCGA
>probe:Drosophila_2:1636502_at:431:639; Interrogation_Position=1560; Antisense; TCGGTGAACCGCGATCTGGAGACAC
>probe:Drosophila_2:1636502_at:605:153; Interrogation_Position=1583; Antisense; ACAGGTGTGCCTTGTGACGGCTAAT
>probe:Drosophila_2:1636502_at:468:377; Interrogation_Position=1635; Antisense; GAAGCTGACCGGCTGTACGATCTGT
>probe:Drosophila_2:1636502_at:565:575; Interrogation_Position=1712; Antisense; GGCCGTCGTTCGCATATTCAGGAAT
>probe:Drosophila_2:1636502_at:95:73; Interrogation_Position=1731; Antisense; AGGAATTTCTTCTAGGCTCTTCGAT
>probe:Drosophila_2:1636502_at:723:693; Interrogation_Position=1772; Antisense; TTTCGTTCTTTGTTAAGCCCCATAT
>probe:Drosophila_2:1636502_at:219:659; Interrogation_Position=1785; Antisense; TAAGCCCCATATCCCAGGTAGTTAA
>probe:Drosophila_2:1636502_at:125:247; Interrogation_Position=1821; Antisense; AATTCGTGTTTAATCTTTGCCCTGG

Paste this into a BLAST search page for me
GCTGCCTACACACTGATAGCCAAGAAGAGTTTCTACGAGAGCCTGGTCCGCACCGCGTTAACTTCTTCGAGTACGGAAAAGCCCGGCTGGACGTACCATGTGTGGTACTACCTGCCAGAGGCAATTGATCGGCTCTTCGAACTTTGGCGATCGGTGAACCGCGATCTGGAGACACACAGGTGTGCCTTGTGACGGCTAATGAAGCTGACCGGCTGTACGATCTGTGGCCGTCGTTCGCATATTCAGGAATAGGAATTTCTTCTAGGCTCTTCGATTTTCGTTCTTTGTTAAGCCCCATATTAAGCCCCATATCCCAGGTAGTTAAAATTCGTGTTTAATCTTTGCCCTGG

Full Affymetrix probeset data:

Annotations for 1636502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720