FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636505_at:

>probe:Drosophila_2:1636505_at:570:387; Interrogation_Position=165; Antisense; GAAAATGGCCCGTGCAATACCGATT
>probe:Drosophila_2:1636505_at:245:565; Interrogation_Position=207; Antisense; GGAATCGCGATCTATTGGCTATTGA
>probe:Drosophila_2:1636505_at:610:403; Interrogation_Position=236; Antisense; GACTTTCAACGTTATATTCGCTCCA
>probe:Drosophila_2:1636505_at:207:319; Interrogation_Position=255; Antisense; GCTCCAAACGTTCTTACCTTTATTG
>probe:Drosophila_2:1636505_at:476:459; Interrogation_Position=280; Antisense; GATTTGCCATCGTAGTAGTCGCCAA
>probe:Drosophila_2:1636505_at:218:247; Interrogation_Position=341; Antisense; AATTCTGGTGTTCGTCTGGCTGATC
>probe:Drosophila_2:1636505_at:204:529; Interrogation_Position=409; Antisense; GGGTTATCTTCCACTACGGAGGATA
>probe:Drosophila_2:1636505_at:11:437; Interrogation_Position=427; Antisense; GAGGATATCGCGAGGCTACCGGAAT
>probe:Drosophila_2:1636505_at:44:215; Interrogation_Position=449; Antisense; AATGAACAACGTTTTCGGTGCCCTG
>probe:Drosophila_2:1636505_at:498:283; Interrogation_Position=471; Antisense; CTGCTCGTTTACATCATCACATTTC
>probe:Drosophila_2:1636505_at:481:151; Interrogation_Position=489; Antisense; ACATTTCTATTGATCCTCTTCAGCG
>probe:Drosophila_2:1636505_at:492:323; Interrogation_Position=511; Antisense; GCGCACGAATTGTGTACTCCTTCTA
>probe:Drosophila_2:1636505_at:339:539; Interrogation_Position=590; Antisense; GGTTTAGTCCTTATCATTCTACACT
>probe:Drosophila_2:1636505_at:17:293; Interrogation_Position=641; Antisense; CGTTCGTTCATCTCAGTGTTTGCAA

Paste this into a BLAST search page for me
GAAAATGGCCCGTGCAATACCGATTGGAATCGCGATCTATTGGCTATTGAGACTTTCAACGTTATATTCGCTCCAGCTCCAAACGTTCTTACCTTTATTGGATTTGCCATCGTAGTAGTCGCCAAAATTCTGGTGTTCGTCTGGCTGATCGGGTTATCTTCCACTACGGAGGATAGAGGATATCGCGAGGCTACCGGAATAATGAACAACGTTTTCGGTGCCCTGCTGCTCGTTTACATCATCACATTTCACATTTCTATTGATCCTCTTCAGCGGCGCACGAATTGTGTACTCCTTCTAGGTTTAGTCCTTATCATTCTACACTCGTTCGTTCATCTCAGTGTTTGCAA

Full Affymetrix probeset data:

Annotations for 1636505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720