Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636507_at:

>probe:Drosophila_2:1636507_at:647:191; Interrogation_Position=1294; Antisense; AACTATTGCCCACCGAGGGTGAGCT
>probe:Drosophila_2:1636507_at:718:511; Interrogation_Position=1312; Antisense; GTGAGCTTCAGCAGTCGCGAGTGAC
>probe:Drosophila_2:1636507_at:676:581; Interrogation_Position=1348; Antisense; TGGCGATCGGTGTTACCTATCCAGA
>probe:Drosophila_2:1636507_at:184:431; Interrogation_Position=1371; Antisense; GAGTCACGGGAGTTTCTGCTATTTC
>probe:Drosophila_2:1636507_at:41:695; Interrogation_Position=1392; Antisense; TTTCCGGACACCCTGCAAGATAGTT
>probe:Drosophila_2:1636507_at:669:251; Interrogation_Position=1407; Antisense; CAAGATAGTTTGCTGCCCCTGGAAC
>probe:Drosophila_2:1636507_at:508:229; Interrogation_Position=1444; Antisense; AATGGTCTCAGCGAAAGCCCACGGA
>probe:Drosophila_2:1636507_at:155:373; Interrogation_Position=1485; Antisense; GAAGTTCGCTTTGCCCTGAAGGAAA
>probe:Drosophila_2:1636507_at:331:361; Interrogation_Position=1522; Antisense; GCAATCTGTTGACCTTTGGCATCTA
>probe:Drosophila_2:1636507_at:417:419; Interrogation_Position=1596; Antisense; GAGCAGCTGGCCTGCGGCTATAGAA
>probe:Drosophila_2:1636507_at:187:51; Interrogation_Position=1662; Antisense; ATGCCGCTGATTATCCTGGCTATTG
>probe:Drosophila_2:1636507_at:396:399; Interrogation_Position=1716; Antisense; GACACGGGTGTCTTAGGCATTTTAA
>probe:Drosophila_2:1636507_at:24:531; Interrogation_Position=1754; Antisense; GGGTTCACATGACGTTGGATTCTTA
>probe:Drosophila_2:1636507_at:303:185; Interrogation_Position=1851; Antisense; AAAATGCTCTCGACTTGTTGATAAT

Paste this into a BLAST search page for me
AACTATTGCCCACCGAGGGTGAGCTGTGAGCTTCAGCAGTCGCGAGTGACTGGCGATCGGTGTTACCTATCCAGAGAGTCACGGGAGTTTCTGCTATTTCTTTCCGGACACCCTGCAAGATAGTTCAAGATAGTTTGCTGCCCCTGGAACAATGGTCTCAGCGAAAGCCCACGGAGAAGTTCGCTTTGCCCTGAAGGAAAGCAATCTGTTGACCTTTGGCATCTAGAGCAGCTGGCCTGCGGCTATAGAAATGCCGCTGATTATCCTGGCTATTGGACACGGGTGTCTTAGGCATTTTAAGGGTTCACATGACGTTGGATTCTTAAAAATGCTCTCGACTTGTTGATAAT

Full Affymetrix probeset data:

Annotations for 1636507_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime