Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636512_s_at:

>probe:Drosophila_2:1636512_s_at:23:123; Interrogation_Position=105; Antisense; AGCCCTTAAAATCTGCATCGAACTG
>probe:Drosophila_2:1636512_s_at:181:275; Interrogation_Position=109; Antisense; CTTAAAATCTGCATCGAACTGGTGG
>probe:Drosophila_2:1636512_s_at:288:251; Interrogation_Position=135; Antisense; CAATGGTGTCTGTGGTGGAGCACTA
>probe:Drosophila_2:1636512_s_at:313:553; Interrogation_Position=151; Antisense; GGAGCACTAGCACATGTAATTCGAA
>probe:Drosophila_2:1636512_s_at:474:55; Interrogation_Position=164; Antisense; ATGTAATTCGAACCATTAGAGAGGA
>probe:Drosophila_2:1636512_s_at:458:463; Interrogation_Position=220; Antisense; GATTCCGGAGAATCGGCTGCATCAA
>probe:Drosophila_2:1636512_s_at:635:201; Interrogation_Position=23; Antisense; AACCGACACAACATAAATCCGACGA
>probe:Drosophila_2:1636512_s_at:369:573; Interrogation_Position=234; Antisense; GGCTGCATCAACAGACTCAACTTTG
>probe:Drosophila_2:1636512_s_at:460:29; Interrogation_Position=35; Antisense; ATAAATCCGACGATCGCTTCACTAT
>probe:Drosophila_2:1636512_s_at:534:409; Interrogation_Position=43; Antisense; GACGATCGCTTCACTATCCTGCAAA
>probe:Drosophila_2:1636512_s_at:264:713; Interrogation_Position=52; Antisense; TTCACTATCCTGCAAACCTTATCGG
>probe:Drosophila_2:1636512_s_at:716:127; Interrogation_Position=67; Antisense; ACCTTATCGGATGTAGTGGACTCTG
>probe:Drosophila_2:1636512_s_at:730:637; Interrogation_Position=73; Antisense; TCGGATGTAGTGGACTCTGGTCTCA
>probe:Drosophila_2:1636512_s_at:346:639; Interrogation_Position=88; Antisense; TCTGGTCTCAGCAAGGAAGCCCTTA

Paste this into a BLAST search page for me
AGCCCTTAAAATCTGCATCGAACTGCTTAAAATCTGCATCGAACTGGTGGCAATGGTGTCTGTGGTGGAGCACTAGGAGCACTAGCACATGTAATTCGAAATGTAATTCGAACCATTAGAGAGGAGATTCCGGAGAATCGGCTGCATCAAAACCGACACAACATAAATCCGACGAGGCTGCATCAACAGACTCAACTTTGATAAATCCGACGATCGCTTCACTATGACGATCGCTTCACTATCCTGCAAATTCACTATCCTGCAAACCTTATCGGACCTTATCGGATGTAGTGGACTCTGTCGGATGTAGTGGACTCTGGTCTCATCTGGTCTCAGCAAGGAAGCCCTTA

Full Affymetrix probeset data:

Annotations for 1636512_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime