FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636514_at:

>probe:Drosophila_2:1636514_at:83:633; Interrogation_Position=2855; Antisense; TCCGCATCCAAATCAGCTTCAGCAT
>probe:Drosophila_2:1636514_at:437:299; Interrogation_Position=2893; Antisense; CGCCTATGCATTTCCTGCAGGATGA
>probe:Drosophila_2:1636514_at:131:375; Interrogation_Position=2967; Antisense; GAAGAAGGCTGGGTGGTCATCCCAC
>probe:Drosophila_2:1636514_at:515:345; Interrogation_Position=2993; Antisense; GCATCACAATGCGTAGTCTCGTGCG
>probe:Drosophila_2:1636514_at:105:507; Interrogation_Position=3013; Antisense; GTGCGCTGCCGATTCGATCGATCGA
>probe:Drosophila_2:1636514_at:455:451; Interrogation_Position=3028; Antisense; GATCGATCGACTCTCTATGTCTTAT
>probe:Drosophila_2:1636514_at:158:61; Interrogation_Position=3044; Antisense; ATGTCTTATAGGCTAGTACTCTACT
>probe:Drosophila_2:1636514_at:326:489; Interrogation_Position=3059; Antisense; GTACTCTACTTTAATCCGCAATATG
>probe:Drosophila_2:1636514_at:486:491; Interrogation_Position=3104; Antisense; GTAATCCAATATTCGTAGTCTGTAT
>probe:Drosophila_2:1636514_at:580:641; Interrogation_Position=3128; Antisense; TCTGTACGATTAACCATAGCACTTT
>probe:Drosophila_2:1636514_at:328:497; Interrogation_Position=3202; Antisense; GTCTAAGCGTATTCAGTCCGTGTTT
>probe:Drosophila_2:1636514_at:451:479; Interrogation_Position=3248; Antisense; GTTTCGATCCATTAGCAGTCTCGCA
>probe:Drosophila_2:1636514_at:650:87; Interrogation_Position=3264; Antisense; AGTCTCGCAAGCTTCGTTTAGGTTT
>probe:Drosophila_2:1636514_at:219:61; Interrogation_Position=3330; Antisense; ATGTATCTGTTCGAGGAAGCTGACA

Paste this into a BLAST search page for me
TCCGCATCCAAATCAGCTTCAGCATCGCCTATGCATTTCCTGCAGGATGAGAAGAAGGCTGGGTGGTCATCCCACGCATCACAATGCGTAGTCTCGTGCGGTGCGCTGCCGATTCGATCGATCGAGATCGATCGACTCTCTATGTCTTATATGTCTTATAGGCTAGTACTCTACTGTACTCTACTTTAATCCGCAATATGGTAATCCAATATTCGTAGTCTGTATTCTGTACGATTAACCATAGCACTTTGTCTAAGCGTATTCAGTCCGTGTTTGTTTCGATCCATTAGCAGTCTCGCAAGTCTCGCAAGCTTCGTTTAGGTTTATGTATCTGTTCGAGGAAGCTGACA

Full Affymetrix probeset data:

Annotations for 1636514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720