Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636515_at:

>probe:Drosophila_2:1636515_at:221:131; Interrogation_Position=503; Antisense; ACCTACTCACTGGTTGGTTCACAGA
>probe:Drosophila_2:1636515_at:423:167; Interrogation_Position=529; Antisense; AAATGTCAATGTCGCTGTTGCCACA
>probe:Drosophila_2:1636515_at:344:61; Interrogation_Position=562; Antisense; ATGTCAAACGCTGTTGCAATCGCTT
>probe:Drosophila_2:1636515_at:231:361; Interrogation_Position=577; Antisense; GCAATCGCTTCGGAGCTCAGTAAAA
>probe:Drosophila_2:1636515_at:385:231; Interrogation_Position=623; Antisense; AATGCTGAGGCAGCTGCATCCGGTG
>probe:Drosophila_2:1636515_at:262:45; Interrogation_Position=640; Antisense; ATCCGGTGCCCAGCAGGAGTTGTGC
>probe:Drosophila_2:1636515_at:296:107; Interrogation_Position=669; Antisense; AGAACCAGCTGGTGGAAACCGCTCG
>probe:Drosophila_2:1636515_at:109:391; Interrogation_Position=683; Antisense; GAAACCGCTCGCCAGAGAGCAGAGA
>probe:Drosophila_2:1636515_at:167:333; Interrogation_Position=726; Antisense; GCTCCGCCAAACTGGACTATACCAA
>probe:Drosophila_2:1636515_at:634:23; Interrogation_Position=744; Antisense; ATACCAACACGAGGAAGGCCGCCTA
>probe:Drosophila_2:1636515_at:378:317; Interrogation_Position=776; Antisense; GCCTGTGCCGCCAACGAAGCAAGGA
>probe:Drosophila_2:1636515_at:106:1; Interrogation_Position=810; Antisense; TAAGGGACCGAAGATCCTACGAGGA
>probe:Drosophila_2:1636515_at:232:357; Interrogation_Position=886; Antisense; GCACAATCACGACCAGCCAGGAAAT
>probe:Drosophila_2:1636515_at:14:17; Interrogation_Position=976; Antisense; ATTTTCTAATTGATGTGCCCTGTAA

Paste this into a BLAST search page for me
ACCTACTCACTGGTTGGTTCACAGAAAATGTCAATGTCGCTGTTGCCACAATGTCAAACGCTGTTGCAATCGCTTGCAATCGCTTCGGAGCTCAGTAAAAAATGCTGAGGCAGCTGCATCCGGTGATCCGGTGCCCAGCAGGAGTTGTGCAGAACCAGCTGGTGGAAACCGCTCGGAAACCGCTCGCCAGAGAGCAGAGAGCTCCGCCAAACTGGACTATACCAAATACCAACACGAGGAAGGCCGCCTAGCCTGTGCCGCCAACGAAGCAAGGATAAGGGACCGAAGATCCTACGAGGAGCACAATCACGACCAGCCAGGAAATATTTTCTAATTGATGTGCCCTGTAA

Full Affymetrix probeset data:

Annotations for 1636515_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime