FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636516_at:

>probe:Drosophila_2:1636516_at:667:605; Interrogation_Position=22; Antisense; TGATCTTCTACGAACCCTATCGTCA
>probe:Drosophila_2:1636516_at:199:671; Interrogation_Position=30; Antisense; TACGAACCCTATCGTCATGCGCTTT
>probe:Drosophila_2:1636516_at:162:205; Interrogation_Position=319; Antisense; AATCGCCGACGGGTCGTCGTACGCG
>probe:Drosophila_2:1636516_at:461:293; Interrogation_Position=325; Antisense; CGACGGGTCGTCGTACGCGTTCGCA
>probe:Drosophila_2:1636516_at:386:381; Interrogation_Position=33; Antisense; GAACCCTATCGTCATGCGCTTTCTA
>probe:Drosophila_2:1636516_at:189:639; Interrogation_Position=332; Antisense; TCGTCGTACGCGTTCGCAGGACGGC
>probe:Drosophila_2:1636516_at:175:349; Interrogation_Position=347; Antisense; GCAGGACGGCCAACTGAAACACCAG
>probe:Drosophila_2:1636516_at:656:127; Interrogation_Position=35; Antisense; ACCCTATCGTCATGCGCTTTCTACT
>probe:Drosophila_2:1636516_at:371:407; Interrogation_Position=351; Antisense; GACGGCCAACTGAAACACCAGATTA
>probe:Drosophila_2:1636516_at:141:1; Interrogation_Position=365; Antisense; ACACCAGATTAATGGTTATTTTCTT
>probe:Drosophila_2:1636516_at:613:703; Interrogation_Position=380; Antisense; TTATTTTCTTTAAAGCCCGTTGCTG
>probe:Drosophila_2:1636516_at:58:699; Interrogation_Position=388; Antisense; TTTAAAGCCCGTTGCTGTCAATCAA
>probe:Drosophila_2:1636516_at:666:203; Interrogation_Position=392; Antisense; AAGCCCGTTGCTGTCAATCAAAATA
>probe:Drosophila_2:1636516_at:430:321; Interrogation_Position=394; Antisense; GCCCGTTGCTGTCAATCAAAATAAA

Paste this into a BLAST search page for me
TGATCTTCTACGAACCCTATCGTCATACGAACCCTATCGTCATGCGCTTTAATCGCCGACGGGTCGTCGTACGCGCGACGGGTCGTCGTACGCGTTCGCAGAACCCTATCGTCATGCGCTTTCTATCGTCGTACGCGTTCGCAGGACGGCGCAGGACGGCCAACTGAAACACCAGACCCTATCGTCATGCGCTTTCTACTGACGGCCAACTGAAACACCAGATTAACACCAGATTAATGGTTATTTTCTTTTATTTTCTTTAAAGCCCGTTGCTGTTTAAAGCCCGTTGCTGTCAATCAAAAGCCCGTTGCTGTCAATCAAAATAGCCCGTTGCTGTCAATCAAAATAAA

Full Affymetrix probeset data:

Annotations for 1636516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720