FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636517_at:

>probe:Drosophila_2:1636517_at:323:105; Interrogation_Position=3586; Antisense; AGACTTCCTCGAACTATAGCTCCAG
>probe:Drosophila_2:1636517_at:685:629; Interrogation_Position=3606; Antisense; TCCAGGGATAGCTACGACTCGAGTG
>probe:Drosophila_2:1636517_at:43:433; Interrogation_Position=3626; Antisense; GAGTGGGTCATATCCCCACGGCTAT
>probe:Drosophila_2:1636517_at:494:681; Interrogation_Position=3648; Antisense; TATGGCTATCCACCGGAACCTCAGA
>probe:Drosophila_2:1636517_at:25:423; Interrogation_Position=3671; Antisense; GAGAAGTCCATACGGTGATCCCAGT
>probe:Drosophila_2:1636517_at:288:717; Interrogation_Position=3706; Antisense; TTCCCCTGACTGTCCGGCAAAAAGG
>probe:Drosophila_2:1636517_at:595:605; Interrogation_Position=3767; Antisense; TGATCAGAGATGTGCCTCCATCTTC
>probe:Drosophila_2:1636517_at:366:131; Interrogation_Position=3846; Antisense; ACCCCATCGGGCTATACAAACGGCA
>probe:Drosophila_2:1636517_at:228:111; Interrogation_Position=3876; Antisense; AGAATTCCTGGTGCTGCTCCGGTCG
>probe:Drosophila_2:1636517_at:687:273; Interrogation_Position=3947; Antisense; CTTCTCCAGCGGCAGTGAATTCGAG
>probe:Drosophila_2:1636517_at:25:615; Interrogation_Position=3962; Antisense; TGAATTCGAGCCACCGTCACCGAGA
>probe:Drosophila_2:1636517_at:290:635; Interrogation_Position=4053; Antisense; TCGCCGGAGGCATTGTGCCCGGAAA
>probe:Drosophila_2:1636517_at:420:319; Interrogation_Position=4069; Antisense; GCCCGGAAAGGCATCGCTCGAGGAT
>probe:Drosophila_2:1636517_at:416:25; Interrogation_Position=4117; Antisense; ATAGTCGCCGGAAGCGCATCCATGA

Paste this into a BLAST search page for me
AGACTTCCTCGAACTATAGCTCCAGTCCAGGGATAGCTACGACTCGAGTGGAGTGGGTCATATCCCCACGGCTATTATGGCTATCCACCGGAACCTCAGAGAGAAGTCCATACGGTGATCCCAGTTTCCCCTGACTGTCCGGCAAAAAGGTGATCAGAGATGTGCCTCCATCTTCACCCCATCGGGCTATACAAACGGCAAGAATTCCTGGTGCTGCTCCGGTCGCTTCTCCAGCGGCAGTGAATTCGAGTGAATTCGAGCCACCGTCACCGAGATCGCCGGAGGCATTGTGCCCGGAAAGCCCGGAAAGGCATCGCTCGAGGATATAGTCGCCGGAAGCGCATCCATGA

Full Affymetrix probeset data:

Annotations for 1636517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720