FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636519_at:

>probe:Drosophila_2:1636519_at:697:361; Interrogation_Position=106; Antisense; GCAATGTTTTTGCACCGCGAAGAGC
>probe:Drosophila_2:1636519_at:185:61; Interrogation_Position=13; Antisense; ATGTGTCTCATAGAGCAAAACAAGG
>probe:Drosophila_2:1636519_at:153:389; Interrogation_Position=140; Antisense; GAAAACTTCATGTCTCTCGGGTTTC
>probe:Drosophila_2:1636519_at:725:59; Interrogation_Position=149; Antisense; ATGTCTCTCGGGTTTCAGTTACCAA
>probe:Drosophila_2:1636519_at:718:685; Interrogation_Position=167; Antisense; TTACCAAAATTCACCTAACCAGCGA
>probe:Drosophila_2:1636519_at:191:1; Interrogation_Position=175; Antisense; ATTCACCTAACCAGCGAACTAATCG
>probe:Drosophila_2:1636519_at:397:383; Interrogation_Position=190; Antisense; GAACTAATCGCTCAAACCAAGCAGA
>probe:Drosophila_2:1636519_at:289:669; Interrogation_Position=218; Antisense; TACGGCAGTGTAGCTTCGAGGATCT
>probe:Drosophila_2:1636519_at:198:11; Interrogation_Position=247; Antisense; ATTCTGGCCAGGGAGACGCTATTCA
>probe:Drosophila_2:1636519_at:706:313; Interrogation_Position=253; Antisense; GCCAGGGAGACGCTATTCAAGAAGA
>probe:Drosophila_2:1636519_at:213:395; Interrogation_Position=287; Antisense; GAAATCTTTACTATCGACGCATGCA
>probe:Drosophila_2:1636519_at:79:411; Interrogation_Position=302; Antisense; GACGCATGCACATACATCAACTGAT
>probe:Drosophila_2:1636519_at:112:225; Interrogation_Position=55; Antisense; AAGGAGAATCCTTCCCAGAACTCAC
>probe:Drosophila_2:1636519_at:469:201; Interrogation_Position=93; Antisense; AACCGCCGCATACGCAATGTTTTTG

Paste this into a BLAST search page for me
GCAATGTTTTTGCACCGCGAAGAGCATGTGTCTCATAGAGCAAAACAAGGGAAAACTTCATGTCTCTCGGGTTTCATGTCTCTCGGGTTTCAGTTACCAATTACCAAAATTCACCTAACCAGCGAATTCACCTAACCAGCGAACTAATCGGAACTAATCGCTCAAACCAAGCAGATACGGCAGTGTAGCTTCGAGGATCTATTCTGGCCAGGGAGACGCTATTCAGCCAGGGAGACGCTATTCAAGAAGAGAAATCTTTACTATCGACGCATGCAGACGCATGCACATACATCAACTGATAAGGAGAATCCTTCCCAGAACTCACAACCGCCGCATACGCAATGTTTTTG

Full Affymetrix probeset data:

Annotations for 1636519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720