FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636521_at:

>probe:Drosophila_2:1636521_at:199:119; Interrogation_Position=5572; Antisense; AGCTCTGCAACTTTACATGTTCCGA
>probe:Drosophila_2:1636521_at:526:597; Interrogation_Position=5589; Antisense; TGTTCCGAGTCCAAATTATCCATTT
>probe:Drosophila_2:1636521_at:622:19; Interrogation_Position=5610; Antisense; ATTTGGACACCACCCATATGGTCAT
>probe:Drosophila_2:1636521_at:602:683; Interrogation_Position=5653; Antisense; TATCCAAGCTATACTCATCCACATA
>probe:Drosophila_2:1636521_at:88:261; Interrogation_Position=5704; Antisense; CACCATTTGACCGTGTTTGATCACT
>probe:Drosophila_2:1636521_at:219:605; Interrogation_Position=5721; Antisense; TGATCACTTAAAGCCGTCCGACATA
>probe:Drosophila_2:1636521_at:370:401; Interrogation_Position=5740; Antisense; GACATAAGTGGATACGGCGGTTTTT
>probe:Drosophila_2:1636521_at:632:357; Interrogation_Position=5806; Antisense; GCAACTACTCGAATACAGCGACTTG
>probe:Drosophila_2:1636521_at:17:643; Interrogation_Position=5844; Antisense; TCTTTTACGATTTTGCGTCCCGCCG
>probe:Drosophila_2:1636521_at:54:301; Interrogation_Position=5864; Antisense; CGCCGCATCTCAGCAATATTTATCA
>probe:Drosophila_2:1636521_at:161:687; Interrogation_Position=5880; Antisense; TATTTATCAATCTCCGGCATTGCCG
>probe:Drosophila_2:1636521_at:478:305; Interrogation_Position=5893; Antisense; CCGGCATTGCCGATTTTACTTTAAG
>probe:Drosophila_2:1636521_at:114:145; Interrogation_Position=5942; Antisense; AAGATAACCAAAGACTCCGCCTAAT
>probe:Drosophila_2:1636521_at:16:89; Interrogation_Position=6052; Antisense; AGTACGATCCCGAAACAATTGTTTG

Paste this into a BLAST search page for me
AGCTCTGCAACTTTACATGTTCCGATGTTCCGAGTCCAAATTATCCATTTATTTGGACACCACCCATATGGTCATTATCCAAGCTATACTCATCCACATACACCATTTGACCGTGTTTGATCACTTGATCACTTAAAGCCGTCCGACATAGACATAAGTGGATACGGCGGTTTTTGCAACTACTCGAATACAGCGACTTGTCTTTTACGATTTTGCGTCCCGCCGCGCCGCATCTCAGCAATATTTATCATATTTATCAATCTCCGGCATTGCCGCCGGCATTGCCGATTTTACTTTAAGAAGATAACCAAAGACTCCGCCTAATAGTACGATCCCGAAACAATTGTTTG

Full Affymetrix probeset data:

Annotations for 1636521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720