FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636523_at:

>probe:Drosophila_2:1636523_at:263:211; Interrogation_Position=118; Antisense; AAGAAGTTCCCATTGCCGTACATTC
>probe:Drosophila_2:1636523_at:169:61; Interrogation_Position=13; Antisense; ATGTCCCACAGTGACTCGGATGAAG
>probe:Drosophila_2:1636523_at:519:489; Interrogation_Position=135; Antisense; GTACATTCGCTTGATGATAGCCCAG
>probe:Drosophila_2:1636523_at:339:413; Interrogation_Position=186; Antisense; GACCTATAATCAATCGGAAGCCCTT
>probe:Drosophila_2:1636523_at:419:201; Interrogation_Position=202; Antisense; GAAGCCCTTAAATGGACCCGCGAAG
>probe:Drosophila_2:1636523_at:484:331; Interrogation_Position=260; Antisense; GCGGCTCTTCTCCAAGATTCAAGCA
>probe:Drosophila_2:1636523_at:618:493; Interrogation_Position=295; Antisense; GTAATGCTTTACCAGCAGACCGGAG
>probe:Drosophila_2:1636523_at:415:311; Interrogation_Position=312; Antisense; GACCGGAGCCGGATGTTTCTACGGA
>probe:Drosophila_2:1636523_at:120:529; Interrogation_Position=350; Antisense; GGGATGAGCTGTCCGATGACTACAT
>probe:Drosophila_2:1636523_at:318:403; Interrogation_Position=367; Antisense; GACTACATAACCTTCACCTTTGATG
>probe:Drosophila_2:1636523_at:709:265; Interrogation_Position=396; Antisense; CAGTTTTATCTGCATTGCTGCCGTT
>probe:Drosophila_2:1636523_at:204:625; Interrogation_Position=414; Antisense; TGCCGTTTTTGGTTGCTATCAGTAC
>probe:Drosophila_2:1636523_at:172:79; Interrogation_Position=56; Antisense; AGGATAAGCCGGCATCTGATGTCAC
>probe:Drosophila_2:1636523_at:614:189; Interrogation_Position=97; Antisense; AACATGGGACCAGCATTCGGCAAGA

Paste this into a BLAST search page for me
AAGAAGTTCCCATTGCCGTACATTCATGTCCCACAGTGACTCGGATGAAGGTACATTCGCTTGATGATAGCCCAGGACCTATAATCAATCGGAAGCCCTTGAAGCCCTTAAATGGACCCGCGAAGGCGGCTCTTCTCCAAGATTCAAGCAGTAATGCTTTACCAGCAGACCGGAGGACCGGAGCCGGATGTTTCTACGGAGGGATGAGCTGTCCGATGACTACATGACTACATAACCTTCACCTTTGATGCAGTTTTATCTGCATTGCTGCCGTTTGCCGTTTTTGGTTGCTATCAGTACAGGATAAGCCGGCATCTGATGTCACAACATGGGACCAGCATTCGGCAAGA

Full Affymetrix probeset data:

Annotations for 1636523_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720