FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636524_at:

>probe:Drosophila_2:1636524_at:297:163; Interrogation_Position=220; Antisense; AAATACCTCGTGGACTTCACTGGGT
>probe:Drosophila_2:1636524_at:494:141; Interrogation_Position=253; Antisense; AACTTTCAGTTGCACGGATTGTCCG
>probe:Drosophila_2:1636524_at:417:465; Interrogation_Position=269; Antisense; GATTGTCCGATTTTGATGTGCCTGC
>probe:Drosophila_2:1636524_at:644:385; Interrogation_Position=324; Antisense; GAACACCATTAACGTTACCTTGCCA
>probe:Drosophila_2:1636524_at:683:257; Interrogation_Position=347; Antisense; CACTCACGTACTTCAAATCCTTATA
>probe:Drosophila_2:1636524_at:684:271; Interrogation_Position=366; Antisense; CTTATACACCGCCAAAGGATCCTTG
>probe:Drosophila_2:1636524_at:443:623; Interrogation_Position=423; Antisense; TGCCGAAACCTCCATTACAAACTTT
>probe:Drosophila_2:1636524_at:99:143; Interrogation_Position=443; Antisense; ACTTTTCAATCCTCATTTCGTTTCG
>probe:Drosophila_2:1636524_at:92:303; Interrogation_Position=485; Antisense; CCCTGGCCATATCTTCATTACAGAT
>probe:Drosophila_2:1636524_at:36:461; Interrogation_Position=574; Antisense; GATTTCATCCATGCTTTGGTGAACG
>probe:Drosophila_2:1636524_at:667:119; Interrogation_Position=611; Antisense; AGCTGCTTGGCGACGTCTGGGATTA
>probe:Drosophila_2:1636524_at:35:567; Interrogation_Position=643; Antisense; GGCACAGTGGTCTCCAAAGTCCAAG
>probe:Drosophila_2:1636524_at:582:537; Interrogation_Position=688; Antisense; GGTCAGTACTCTCTGTCGGATATAA
>probe:Drosophila_2:1636524_at:316:463; Interrogation_Position=778; Antisense; GATTGCAAGCCGGATGCTACCACGA

Paste this into a BLAST search page for me
AAATACCTCGTGGACTTCACTGGGTAACTTTCAGTTGCACGGATTGTCCGGATTGTCCGATTTTGATGTGCCTGCGAACACCATTAACGTTACCTTGCCACACTCACGTACTTCAAATCCTTATACTTATACACCGCCAAAGGATCCTTGTGCCGAAACCTCCATTACAAACTTTACTTTTCAATCCTCATTTCGTTTCGCCCTGGCCATATCTTCATTACAGATGATTTCATCCATGCTTTGGTGAACGAGCTGCTTGGCGACGTCTGGGATTAGGCACAGTGGTCTCCAAAGTCCAAGGGTCAGTACTCTCTGTCGGATATAAGATTGCAAGCCGGATGCTACCACGA

Full Affymetrix probeset data:

Annotations for 1636524_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720