FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636525_at:

>probe:Drosophila_2:1636525_at:613:673; Interrogation_Position=114; Antisense; TAGCACACTTCGTCCCAAGATTAAT
>probe:Drosophila_2:1636525_at:333:79; Interrogation_Position=146; Antisense; AGGTTTTTCACGTGAACTGCTGCAA
>probe:Drosophila_2:1636525_at:273:145; Interrogation_Position=161; Antisense; ACTGCTGCAAGTACAAGATCCGTTC
>probe:Drosophila_2:1636525_at:220:215; Interrogation_Position=175; Antisense; AAGATCCGTTCGAGACCCATGAGGC
>probe:Drosophila_2:1636525_at:374:617; Interrogation_Position=269; Antisense; TGCATCATCCTGTCCGGCGGAAGGT
>probe:Drosophila_2:1636525_at:200:523; Interrogation_Position=291; Antisense; GGTGGTCCATATGCCGGAAACCGTG
>probe:Drosophila_2:1636525_at:57:393; Interrogation_Position=307; Antisense; GAAACCGTGGTCATGCACATGCGGA
>probe:Drosophila_2:1636525_at:618:373; Interrogation_Position=368; Antisense; GAAGAACCCTTATTCAAACCCATGT
>probe:Drosophila_2:1636525_at:254:719; Interrogation_Position=392; Antisense; TTCCTTCGCCGGATGTGGATGATGA
>probe:Drosophila_2:1636525_at:463:237; Interrogation_Position=432; Antisense; AATCGATCGGAGGTCAAGGCAAGCC
>probe:Drosophila_2:1636525_at:454:1; Interrogation_Position=46; Antisense; GTTAAAGTCCACTCGAAGGTCCATC
>probe:Drosophila_2:1636525_at:688:167; Interrogation_Position=470; Antisense; AAATGAGACCCTTATCCAGCGACGT
>probe:Drosophila_2:1636525_at:575:399; Interrogation_Position=505; Antisense; GACATGGATGTGGACCCGTTTCAGT
>probe:Drosophila_2:1636525_at:590:219; Interrogation_Position=61; Antisense; AAGGTCCATCCTCCTCAGAAAATTA

Paste this into a BLAST search page for me
TAGCACACTTCGTCCCAAGATTAATAGGTTTTTCACGTGAACTGCTGCAAACTGCTGCAAGTACAAGATCCGTTCAAGATCCGTTCGAGACCCATGAGGCTGCATCATCCTGTCCGGCGGAAGGTGGTGGTCCATATGCCGGAAACCGTGGAAACCGTGGTCATGCACATGCGGAGAAGAACCCTTATTCAAACCCATGTTTCCTTCGCCGGATGTGGATGATGAAATCGATCGGAGGTCAAGGCAAGCCGTTAAAGTCCACTCGAAGGTCCATCAAATGAGACCCTTATCCAGCGACGTGACATGGATGTGGACCCGTTTCAGTAAGGTCCATCCTCCTCAGAAAATTA

Full Affymetrix probeset data:

Annotations for 1636525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720