FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636526_at:

>probe:Drosophila_2:1636526_at:47:127; Interrogation_Position=1001; Antisense; AGCCAATCGCAAGATGTTCCTTTCC
>probe:Drosophila_2:1636526_at:56:159; Interrogation_Position=1047; Antisense; ACAAATGTGCTATCCGCCTTGAATG
>probe:Drosophila_2:1636526_at:471:343; Interrogation_Position=1093; Antisense; GCTTCTCGTCGTTGATTGCATTTGA
>probe:Drosophila_2:1636526_at:336:225; Interrogation_Position=1182; Antisense; AAGGAGCCTCAGCAGCTGCAGATTC
>probe:Drosophila_2:1636526_at:81:265; Interrogation_Position=1200; Antisense; CAGATTCCCGGCTGCGAGAAACAGT
>probe:Drosophila_2:1636526_at:586:421; Interrogation_Position=1215; Antisense; GAGAAACAGTGTCCCATTGGCAAGT
>probe:Drosophila_2:1636526_at:193:31; Interrogation_Position=1260; Antisense; ATAATTCCCGATGCGCCTTATGCAG
>probe:Drosophila_2:1636526_at:395:167; Interrogation_Position=1297; Antisense; CGAAGGGAACTCAAGGCGGCGCTAA
>probe:Drosophila_2:1636526_at:600:243; Interrogation_Position=1406; Antisense; AATTGTGTAACTGCTTCGTGTAACT
>probe:Drosophila_2:1636526_at:593:413; Interrogation_Position=845; Antisense; GACCAATGACTACTTTCCGGAGAAG
>probe:Drosophila_2:1636526_at:390:375; Interrogation_Position=866; Antisense; GAAGATGCTACCCTTGGCTGAAAAG
>probe:Drosophila_2:1636526_at:422:497; Interrogation_Position=890; Antisense; GTCATATGTCTACGATGCCTATACG
>probe:Drosophila_2:1636526_at:105:479; Interrogation_Position=940; Antisense; GTTTCTTCGTGGAGCTGCTGTTGAA
>probe:Drosophila_2:1636526_at:622:545; Interrogation_Position=979; Antisense; GGATCTCCGGAGCATTGAAGCCAGC

Paste this into a BLAST search page for me
AGCCAATCGCAAGATGTTCCTTTCCACAAATGTGCTATCCGCCTTGAATGGCTTCTCGTCGTTGATTGCATTTGAAAGGAGCCTCAGCAGCTGCAGATTCCAGATTCCCGGCTGCGAGAAACAGTGAGAAACAGTGTCCCATTGGCAAGTATAATTCCCGATGCGCCTTATGCAGCGAAGGGAACTCAAGGCGGCGCTAAAATTGTGTAACTGCTTCGTGTAACTGACCAATGACTACTTTCCGGAGAAGGAAGATGCTACCCTTGGCTGAAAAGGTCATATGTCTACGATGCCTATACGGTTTCTTCGTGGAGCTGCTGTTGAAGGATCTCCGGAGCATTGAAGCCAGC

Full Affymetrix probeset data:

Annotations for 1636526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720