FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636528_at:

>probe:Drosophila_2:1636528_at:232:445; Interrogation_Position=2326; Antisense; GATGACACCGCCAAGGACATGGCTG
>probe:Drosophila_2:1636528_at:684:399; Interrogation_Position=2341; Antisense; GACATGGCTGTGATGATGTTCCGCA
>probe:Drosophila_2:1636528_at:255:53; Interrogation_Position=2389; Antisense; ATGCTCCAGGAGACTTCGCAGTTCG
>probe:Drosophila_2:1636528_at:508:635; Interrogation_Position=2404; Antisense; TCGCAGTTCGCCGACAGTATTGAGC
>probe:Drosophila_2:1636528_at:726:3; Interrogation_Position=2422; Antisense; ATTGAGCAGATGATGCGCCAGACCT
>probe:Drosophila_2:1636528_at:439:1; Interrogation_Position=2441; Antisense; AGACCTTGGGTGTCTCCCAAGACGA
>probe:Drosophila_2:1636528_at:580:547; Interrogation_Position=2493; Antisense; GGATGATGCCGAGGAGACCGCCACC
>probe:Drosophila_2:1636528_at:196:295; Interrogation_Position=2568; Antisense; CGACGAGCTGTAAACTACTTCACCT
>probe:Drosophila_2:1636528_at:278:281; Interrogation_Position=2591; Antisense; CTCACCCACTGTCCAAATAGATTGT
>probe:Drosophila_2:1636528_at:116:265; Interrogation_Position=2634; Antisense; CAGACTGAGTTTTAAACCGCCACCG
>probe:Drosophila_2:1636528_at:568:523; Interrogation_Position=2666; Antisense; GGGCGGGCACTCCATCAACATTACA
>probe:Drosophila_2:1636528_at:99:33; Interrogation_Position=2709; Antisense; ATAATTTCGTAGTCCTTCGCCCACG
>probe:Drosophila_2:1636528_at:634:17; Interrogation_Position=2771; Antisense; ATTTCAGCCAGCACACTTGGTTGCT
>probe:Drosophila_2:1636528_at:251:619; Interrogation_Position=2792; Antisense; TGCTCAAGCGTTTTCTTTTTTCGAA

Paste this into a BLAST search page for me
GATGACACCGCCAAGGACATGGCTGGACATGGCTGTGATGATGTTCCGCAATGCTCCAGGAGACTTCGCAGTTCGTCGCAGTTCGCCGACAGTATTGAGCATTGAGCAGATGATGCGCCAGACCTAGACCTTGGGTGTCTCCCAAGACGAGGATGATGCCGAGGAGACCGCCACCCGACGAGCTGTAAACTACTTCACCTCTCACCCACTGTCCAAATAGATTGTCAGACTGAGTTTTAAACCGCCACCGGGGCGGGCACTCCATCAACATTACAATAATTTCGTAGTCCTTCGCCCACGATTTCAGCCAGCACACTTGGTTGCTTGCTCAAGCGTTTTCTTTTTTCGAA

Full Affymetrix probeset data:

Annotations for 1636528_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720