Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636529_at:

>probe:Drosophila_2:1636529_at:133:421; Interrogation_Position=15; Antisense; GAGCACTTCTGACTTCGAGTTTACA
>probe:Drosophila_2:1636529_at:660:455; Interrogation_Position=171; Antisense; GATAGCCTCGCTGGTGGAATTCACG
>probe:Drosophila_2:1636529_at:688:135; Interrogation_Position=193; Antisense; ACGAATATCAAGTGCACCTCCTGGG
>probe:Drosophila_2:1636529_at:173:261; Interrogation_Position=207; Antisense; CACCTCCTGGGATAAAGCGTTTGAT
>probe:Drosophila_2:1636529_at:204:7; Interrogation_Position=242; Antisense; ATTGCCATCTGAAGTCGGTTAACCG
>probe:Drosophila_2:1636529_at:429:289; Interrogation_Position=265; Antisense; CGGAGCTTTAAGTACTTGTCGCTTA
>probe:Drosophila_2:1636529_at:454:221; Interrogation_Position=304; Antisense; AAGGTGAACTTCTCTTTGCTCAAAC
>probe:Drosophila_2:1636529_at:116:23; Interrogation_Position=359; Antisense; ATATCACTGTCGATGCTTGCAAAGC
>probe:Drosophila_2:1636529_at:263:269; Interrogation_Position=374; Antisense; CTTGCAAAGCCCTGAGACACTCGAA
>probe:Drosophila_2:1636529_at:343:491; Interrogation_Position=399; Antisense; GTACAATCCGATATTCAGTTTCTTT
>probe:Drosophila_2:1636529_at:522:129; Interrogation_Position=460; Antisense; ACCTGCCCATTCGATCATGATCTAA
>probe:Drosophila_2:1636529_at:597:287; Interrogation_Position=528; Antisense; CGGAGACATCAAGTTTCCCCATGGG
>probe:Drosophila_2:1636529_at:698:409; Interrogation_Position=73; Antisense; GACGACTTTGAGTACTGCCATCTGA
>probe:Drosophila_2:1636529_at:399:627; Interrogation_Position=88; Antisense; TGCCATCTGAAGTCTGTGAATCGTA

Paste this into a BLAST search page for me
GAGCACTTCTGACTTCGAGTTTACAGATAGCCTCGCTGGTGGAATTCACGACGAATATCAAGTGCACCTCCTGGGCACCTCCTGGGATAAAGCGTTTGATATTGCCATCTGAAGTCGGTTAACCGCGGAGCTTTAAGTACTTGTCGCTTAAAGGTGAACTTCTCTTTGCTCAAACATATCACTGTCGATGCTTGCAAAGCCTTGCAAAGCCCTGAGACACTCGAAGTACAATCCGATATTCAGTTTCTTTACCTGCCCATTCGATCATGATCTAACGGAGACATCAAGTTTCCCCATGGGGACGACTTTGAGTACTGCCATCTGATGCCATCTGAAGTCTGTGAATCGTA

Full Affymetrix probeset data:

Annotations for 1636529_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime