FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636533_at:

>probe:Drosophila_2:1636533_at:151:661; Interrogation_Position=1030; Antisense; TAAAAGGTGTCGCATCCGGCTGAAG
>probe:Drosophila_2:1636533_at:410:441; Interrogation_Position=1067; Antisense; GATGATTATTTACCCTTAGCTAGAA
>probe:Drosophila_2:1636533_at:177:675; Interrogation_Position=1087; Antisense; TAGAATACGGCGCTCAAGGCGGCCT
>probe:Drosophila_2:1636533_at:64:575; Interrogation_Position=1104; Antisense; GGCGGCCTACGCTGAGAACATGACT
>probe:Drosophila_2:1636533_at:350:77; Interrogation_Position=588; Antisense; AGGAGTTTCTTCTCAGTCAGTTGCC
>probe:Drosophila_2:1636533_at:639:263; Interrogation_Position=601; Antisense; CAGTCAGTTGCCTTTCGTGAAATCT
>probe:Drosophila_2:1636533_at:556:271; Interrogation_Position=647; Antisense; CATTTAGAAGTGGAGGTCCTCGCCC
>probe:Drosophila_2:1636533_at:16:207; Interrogation_Position=699; Antisense; AAGCTACTCGAAAGCTGGGTCCTAA
>probe:Drosophila_2:1636533_at:55:535; Interrogation_Position=775; Antisense; GGTGAAAGAGCTCCCAGCAGACAAT
>probe:Drosophila_2:1636533_at:492:105; Interrogation_Position=793; Antisense; AGACAATTTACTCAGTCCGGCCATG
>probe:Drosophila_2:1636533_at:547:305; Interrogation_Position=809; Antisense; CCGGCCATGGACAGATTCGGCATTA
>probe:Drosophila_2:1636533_at:286:211; Interrogation_Position=847; Antisense; AAGACCCAATGTCGCAAGTGCCAAT
>probe:Drosophila_2:1636533_at:504:411; Interrogation_Position=978; Antisense; GACCGATAGAAACACCACGCTTCGT
>probe:Drosophila_2:1636533_at:700:319; Interrogation_Position=996; Antisense; GCTTCGTTCCTCTTAAAAGCGCGAA

Paste this into a BLAST search page for me
TAAAAGGTGTCGCATCCGGCTGAAGGATGATTATTTACCCTTAGCTAGAATAGAATACGGCGCTCAAGGCGGCCTGGCGGCCTACGCTGAGAACATGACTAGGAGTTTCTTCTCAGTCAGTTGCCCAGTCAGTTGCCTTTCGTGAAATCTCATTTAGAAGTGGAGGTCCTCGCCCAAGCTACTCGAAAGCTGGGTCCTAAGGTGAAAGAGCTCCCAGCAGACAATAGACAATTTACTCAGTCCGGCCATGCCGGCCATGGACAGATTCGGCATTAAAGACCCAATGTCGCAAGTGCCAATGACCGATAGAAACACCACGCTTCGTGCTTCGTTCCTCTTAAAAGCGCGAA

Full Affymetrix probeset data:

Annotations for 1636533_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720