FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636535_at:

>probe:Drosophila_2:1636535_at:672:449; Interrogation_Position=154; Antisense; GATCGCCGCCGATTGGAACAATGCT
>probe:Drosophila_2:1636535_at:668:709; Interrogation_Position=263; Antisense; TTCAGCTGGTGGCTCGAACCTTTAG
>probe:Drosophila_2:1636535_at:85:367; Interrogation_Position=278; Antisense; GAACCTTTAGCTGCGTGGACCACGG
>probe:Drosophila_2:1636535_at:134:375; Interrogation_Position=324; Antisense; GAAGATCGGCCAGCGGCTAATTTCC
>probe:Drosophila_2:1636535_at:304:263; Interrogation_Position=360; Antisense; CAGCGCCTGTTGGAGTCACGTGAAT
>probe:Drosophila_2:1636535_at:723:517; Interrogation_Position=430; Antisense; GTGGGCATCATCTCCAATTTCGATT
>probe:Drosophila_2:1636535_at:106:245; Interrogation_Position=445; Antisense; AATTTCGATTCGTCACTGCCACAAG
>probe:Drosophila_2:1636535_at:418:717; Interrogation_Position=499; Antisense; TTCGATTTCATTCTGACTTCCTACG
>probe:Drosophila_2:1636535_at:114:149; Interrogation_Position=514; Antisense; ACTTCCTACGAAGCCGGTGTTATGA
>probe:Drosophila_2:1636535_at:427:679; Interrogation_Position=534; Antisense; TATGAAGCCCGAACGCGGTATCTTC
>probe:Drosophila_2:1636535_at:369:539; Interrogation_Position=550; Antisense; GGTATCTTCGAAATTCCGCTGCAGA
>probe:Drosophila_2:1636535_at:192:69; Interrogation_Position=596; Antisense; AGGCCCTTCACATTGGCAACAAGTT
>probe:Drosophila_2:1636535_at:37:727; Interrogation_Position=668; Antisense; TTGTGAGCAACGCTGACAATCCCCA
>probe:Drosophila_2:1636535_at:498:11; Interrogation_Position=692; Antisense; ATTCTTTTGCCAGTCTTTCCAGTCT

Paste this into a BLAST search page for me
GATCGCCGCCGATTGGAACAATGCTTTCAGCTGGTGGCTCGAACCTTTAGGAACCTTTAGCTGCGTGGACCACGGGAAGATCGGCCAGCGGCTAATTTCCCAGCGCCTGTTGGAGTCACGTGAATGTGGGCATCATCTCCAATTTCGATTAATTTCGATTCGTCACTGCCACAAGTTCGATTTCATTCTGACTTCCTACGACTTCCTACGAAGCCGGTGTTATGATATGAAGCCCGAACGCGGTATCTTCGGTATCTTCGAAATTCCGCTGCAGAAGGCCCTTCACATTGGCAACAAGTTTTGTGAGCAACGCTGACAATCCCCAATTCTTTTGCCAGTCTTTCCAGTCT

Full Affymetrix probeset data:

Annotations for 1636535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720