FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636536_at:

>probe:Drosophila_2:1636536_at:542:421; Interrogation_Position=1010; Antisense; GAGCAATCAGCTCAATGCACTTGTA
>probe:Drosophila_2:1636536_at:408:635; Interrogation_Position=1055; Antisense; TCGAAAGTGGTGCTCACTGTGGCCA
>probe:Drosophila_2:1636536_at:625:213; Interrogation_Position=1128; Antisense; AAGAGTCAACAACGATGGGCTGGCT
>probe:Drosophila_2:1636536_at:509:645; Interrogation_Position=1176; Antisense; TCTTGGTCTTGGTCTCTGGAACTCA
>probe:Drosophila_2:1636536_at:727:607; Interrogation_Position=1256; Antisense; TGAGCCAAAGTCCAGCCGTATTTAT
>probe:Drosophila_2:1636536_at:349:63; Interrogation_Position=1281; Antisense; ATGTGTTTCCATTGCGCTCGTTTAA
>probe:Drosophila_2:1636536_at:139:295; Interrogation_Position=1319; Antisense; CGAGTGTGTCGCGTCAATTTTAATT
>probe:Drosophila_2:1636536_at:570:545; Interrogation_Position=1350; Antisense; GGATGAGTCTGAGCAGCCTCTGGCA
>probe:Drosophila_2:1636536_at:278:641; Interrogation_Position=1368; Antisense; TCTGGCATTCCGAACGGGTCGAATT
>probe:Drosophila_2:1636536_at:444:581; Interrogation_Position=841; Antisense; TGGCATTCCTTTCGTCTACGAACTA
>probe:Drosophila_2:1636536_at:205:665; Interrogation_Position=864; Antisense; TAGACGAGAGCCTCAAGCCTTTGGC
>probe:Drosophila_2:1636536_at:400:137; Interrogation_Position=890; Antisense; ACGTTGAAGTTCCTCGGCGATCCGG
>probe:Drosophila_2:1636536_at:45:527; Interrogation_Position=952; Antisense; GGGCAAAGCCAAGTGATCCGTGATT
>probe:Drosophila_2:1636536_at:347:603; Interrogation_Position=965; Antisense; TGATCCGTGATTTTGGGTATACCCA

Paste this into a BLAST search page for me
GAGCAATCAGCTCAATGCACTTGTATCGAAAGTGGTGCTCACTGTGGCCAAAGAGTCAACAACGATGGGCTGGCTTCTTGGTCTTGGTCTCTGGAACTCATGAGCCAAAGTCCAGCCGTATTTATATGTGTTTCCATTGCGCTCGTTTAACGAGTGTGTCGCGTCAATTTTAATTGGATGAGTCTGAGCAGCCTCTGGCATCTGGCATTCCGAACGGGTCGAATTTGGCATTCCTTTCGTCTACGAACTATAGACGAGAGCCTCAAGCCTTTGGCACGTTGAAGTTCCTCGGCGATCCGGGGGCAAAGCCAAGTGATCCGTGATTTGATCCGTGATTTTGGGTATACCCA

Full Affymetrix probeset data:

Annotations for 1636536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720