FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636537_at:

>probe:Drosophila_2:1636537_at:684:525; Interrogation_Position=1020; Antisense; GGGAAGAGCCATAACCTACCTGGAA
>probe:Drosophila_2:1636537_at:268:729; Interrogation_Position=1105; Antisense; TTGGGCACCGGACTCAAGATGACGA
>probe:Drosophila_2:1636537_at:144:77; Interrogation_Position=1157; Antisense; AGGAGATGGACAACCTGCGGCACTT
>probe:Drosophila_2:1636537_at:110:485; Interrogation_Position=1202; Antisense; GTATGGTGACCAATCGCCTTTCAAA
>probe:Drosophila_2:1636537_at:678:131; Interrogation_Position=1231; Antisense; ACCGTGCGCCTTGTCAATATGCAGA
>probe:Drosophila_2:1636537_at:90:363; Interrogation_Position=1270; Antisense; GAATACGTGCTTTTCCAGGACTACT
>probe:Drosophila_2:1636537_at:688:647; Interrogation_Position=1304; Antisense; TCACCAATATCCTGTCCCTAGAGAA
>probe:Drosophila_2:1636537_at:128:153; Interrogation_Position=1331; Antisense; ACATGTCGCTGACGAACTCCAAGCA
>probe:Drosophila_2:1636537_at:253:385; Interrogation_Position=1395; Antisense; GAACAGCATCGTGGATCGCAACTAG
>probe:Drosophila_2:1636537_at:277:257; Interrogation_Position=833; Antisense; CAAAGGATCTGGTGCAGGCTGCCGA
>probe:Drosophila_2:1636537_at:162:627; Interrogation_Position=852; Antisense; TGCCGAGTCTACAGCCTTCAATGGA
>probe:Drosophila_2:1636537_at:688:227; Interrogation_Position=871; Antisense; AATGGAGCTCTTTGGCCATACGGCA
>probe:Drosophila_2:1636537_at:78:535; Interrogation_Position=898; Antisense; GGTGCCTTTGTCAATTCAGCCAACA
>probe:Drosophila_2:1636537_at:325:365; Interrogation_Position=959; Antisense; GAATAATCTCCACGACTAGCAGCAA

Paste this into a BLAST search page for me
GGGAAGAGCCATAACCTACCTGGAATTGGGCACCGGACTCAAGATGACGAAGGAGATGGACAACCTGCGGCACTTGTATGGTGACCAATCGCCTTTCAAAACCGTGCGCCTTGTCAATATGCAGAGAATACGTGCTTTTCCAGGACTACTTCACCAATATCCTGTCCCTAGAGAAACATGTCGCTGACGAACTCCAAGCAGAACAGCATCGTGGATCGCAACTAGCAAAGGATCTGGTGCAGGCTGCCGATGCCGAGTCTACAGCCTTCAATGGAAATGGAGCTCTTTGGCCATACGGCAGGTGCCTTTGTCAATTCAGCCAACAGAATAATCTCCACGACTAGCAGCAA

Full Affymetrix probeset data:

Annotations for 1636537_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720