Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636541_at:

>probe:Drosophila_2:1636541_at:319:95; Interrogation_Position=1051; Antisense; AGAAAGTGGGTCTGTCGCCAACCGA
>probe:Drosophila_2:1636541_at:120:311; Interrogation_Position=1067; Antisense; GCCAACCGATGATTGCCAACCGATT
>probe:Drosophila_2:1636541_at:697:603; Interrogation_Position=1091; Antisense; TGATTTAACTCAACAAAGCCCCTAA
>probe:Drosophila_2:1636541_at:498:121; Interrogation_Position=1167; Antisense; AGCGGTGTTTGCTTAACTTGACCAA
>probe:Drosophila_2:1636541_at:51:687; Interrogation_Position=1195; Antisense; TATCAATTTGTTGCTCCCTGAAATA
>probe:Drosophila_2:1636541_at:325:489; Interrogation_Position=1246; Antisense; GTACTAATTTTCCATCGGCTATATT
>probe:Drosophila_2:1636541_at:53:397; Interrogation_Position=1301; Antisense; GAAATATGTCGAATGCGCTCTAATA
>probe:Drosophila_2:1636541_at:245:313; Interrogation_Position=802; Antisense; GCCACGAGCTGTCCAAGCTGGAAAG
>probe:Drosophila_2:1636541_at:272:85; Interrogation_Position=825; Antisense; AGTGATCTGGCCGTGGACGTAGCTC
>probe:Drosophila_2:1636541_at:470:233; Interrogation_Position=870; Antisense; AATGCCTGCATACATTTTGCCAATG
>probe:Drosophila_2:1636541_at:236:165; Interrogation_Position=913; Antisense; AAATCGAGGCTCAGTTCTTGCGGGC
>probe:Drosophila_2:1636541_at:94:331; Interrogation_Position=932; Antisense; GCGGGCCAAGATAGAGCTGCACAAT
>probe:Drosophila_2:1636541_at:168:621; Interrogation_Position=976; Antisense; TGCTCACAGAGCATCTATGCACAGT
>probe:Drosophila_2:1636541_at:592:491; Interrogation_Position=999; Antisense; GTAATTGCCCACAACGAGGACCGTA

Paste this into a BLAST search page for me
AGAAAGTGGGTCTGTCGCCAACCGAGCCAACCGATGATTGCCAACCGATTTGATTTAACTCAACAAAGCCCCTAAAGCGGTGTTTGCTTAACTTGACCAATATCAATTTGTTGCTCCCTGAAATAGTACTAATTTTCCATCGGCTATATTGAAATATGTCGAATGCGCTCTAATAGCCACGAGCTGTCCAAGCTGGAAAGAGTGATCTGGCCGTGGACGTAGCTCAATGCCTGCATACATTTTGCCAATGAAATCGAGGCTCAGTTCTTGCGGGCGCGGGCCAAGATAGAGCTGCACAATTGCTCACAGAGCATCTATGCACAGTGTAATTGCCCACAACGAGGACCGTA

Full Affymetrix probeset data:

Annotations for 1636541_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime