FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636542_at:

>probe:Drosophila_2:1636542_at:223:519; Interrogation_Position=146; Antisense; GTGGATGCAGCAGCACCGTAATCTC
>probe:Drosophila_2:1636542_at:283:271; Interrogation_Position=183; Antisense; CATACTGGGCGGTCTTGGCAAGCCG
>probe:Drosophila_2:1636542_at:100:43; Interrogation_Position=279; Antisense; ATCGTCGACGGCCACTTTGGCAGCT
>probe:Drosophila_2:1636542_at:511:297; Interrogation_Position=317; Antisense; CGCACAGTAGCGGAGTGGGCACATT
>probe:Drosophila_2:1636542_at:645:565; Interrogation_Position=334; Antisense; GGCACATTGCCACCGGGACTCGGAA
>probe:Drosophila_2:1636542_at:488:207; Interrogation_Position=357; Antisense; AAGCGGCGGTGGCTACATACTGAAC
>probe:Drosophila_2:1636542_at:682:667; Interrogation_Position=374; Antisense; TACTGAACGCTTATGCCAGCGGGCG
>probe:Drosophila_2:1636542_at:271:259; Interrogation_Position=517; Antisense; CACTCCGGCTCAAGTCTTTTGATGG
>probe:Drosophila_2:1636542_at:177:607; Interrogation_Position=557; Antisense; TGATGGGCGTTGTGGGATCCACCAC
>probe:Drosophila_2:1636542_at:188:201; Interrogation_Position=591; Antisense; AACCTCGTGTAACTCCTCGCAGGAT
>probe:Drosophila_2:1636542_at:554:635; Interrogation_Position=607; Antisense; TCGCAGGATCTGGACGATAACATCA
>probe:Drosophila_2:1636542_at:628:657; Interrogation_Position=645; Antisense; TAAGGACTGCCTCATGACGCAGCGA
>probe:Drosophila_2:1636542_at:72:327; Interrogation_Position=666; Antisense; GCGAGTGCCCGAGAGTTGTGTCTAA
>probe:Drosophila_2:1636542_at:213:165; Interrogation_Position=95; Antisense; AAATCAACGCGCAACGGGCGCAGCT

Paste this into a BLAST search page for me
GTGGATGCAGCAGCACCGTAATCTCCATACTGGGCGGTCTTGGCAAGCCGATCGTCGACGGCCACTTTGGCAGCTCGCACAGTAGCGGAGTGGGCACATTGGCACATTGCCACCGGGACTCGGAAAAGCGGCGGTGGCTACATACTGAACTACTGAACGCTTATGCCAGCGGGCGCACTCCGGCTCAAGTCTTTTGATGGTGATGGGCGTTGTGGGATCCACCACAACCTCGTGTAACTCCTCGCAGGATTCGCAGGATCTGGACGATAACATCATAAGGACTGCCTCATGACGCAGCGAGCGAGTGCCCGAGAGTTGTGTCTAAAAATCAACGCGCAACGGGCGCAGCT

Full Affymetrix probeset data:

Annotations for 1636542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720