Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636543_a_at:

>probe:Drosophila_2:1636543_a_at:706:551; Interrogation_Position=490; Antisense; GGAGACATATCTGTACGATCCTAAT
>probe:Drosophila_2:1636543_a_at:222:41; Interrogation_Position=498; Antisense; ATCTGTACGATCCTAATCTGCTGCT
>probe:Drosophila_2:1636543_a_at:644:487; Interrogation_Position=502; Antisense; GTACGATCCTAATCTGCTGCTAAAG
>probe:Drosophila_2:1636543_a_at:519:237; Interrogation_Position=512; Antisense; AATCTGCTGCTAAAGCTGGACTTTC
>probe:Drosophila_2:1636543_a_at:666:339; Interrogation_Position=520; Antisense; GCTAAAGCTGGACTTTCATCGCAGT
>probe:Drosophila_2:1636543_a_at:473:697; Interrogation_Position=533; Antisense; TTTCATCGCAGTCCCGCCAACTTTA
>probe:Drosophila_2:1636543_a_at:580:189; Interrogation_Position=551; Antisense; AACTTTAAGCCCTTCATATCGGCGG
>probe:Drosophila_2:1636543_a_at:92:251; Interrogation_Position=577; Antisense; CAATCCCGGCGAGCCCTGGATGAAA
>probe:Drosophila_2:1636543_a_at:317:125; Interrogation_Position=588; Antisense; AGCCCTGGATGAAAGTGCGTCCTCT
>probe:Drosophila_2:1636543_a_at:226:287; Interrogation_Position=592; Antisense; CTGGATGAAAGTGCGTCCTCTCAAG
>probe:Drosophila_2:1636543_a_at:358:225; Interrogation_Position=614; Antisense; AAGGACACCGACTACGATCGTGGAT
>probe:Drosophila_2:1636543_a_at:11:405; Interrogation_Position=623; Antisense; GACTACGATCGTGGATTCCTGCAGC
>probe:Drosophila_2:1636543_a_at:64:139; Interrogation_Position=627; Antisense; ACGATCGTGGATTCCTGCAGCTGCT
>probe:Drosophila_2:1636543_a_at:445:589; Interrogation_Position=634; Antisense; TGGATTCCTGCAGCTGCTCTCGCAA

Paste this into a BLAST search page for me
GGAGACATATCTGTACGATCCTAATATCTGTACGATCCTAATCTGCTGCTGTACGATCCTAATCTGCTGCTAAAGAATCTGCTGCTAAAGCTGGACTTTCGCTAAAGCTGGACTTTCATCGCAGTTTTCATCGCAGTCCCGCCAACTTTAAACTTTAAGCCCTTCATATCGGCGGCAATCCCGGCGAGCCCTGGATGAAAAGCCCTGGATGAAAGTGCGTCCTCTCTGGATGAAAGTGCGTCCTCTCAAGAAGGACACCGACTACGATCGTGGATGACTACGATCGTGGATTCCTGCAGCACGATCGTGGATTCCTGCAGCTGCTTGGATTCCTGCAGCTGCTCTCGCAA

Full Affymetrix probeset data:

Annotations for 1636543_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime