Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636544_at:

>probe:Drosophila_2:1636544_at:367:135; Interrogation_Position=1006; Antisense; ACGAATCAATTCTCCGTCACGCGAT
>probe:Drosophila_2:1636544_at:507:97; Interrogation_Position=1038; Antisense; AGATCTTTCAGATCGCGAGCGCGGA
>probe:Drosophila_2:1636544_at:78:531; Interrogation_Position=1069; Antisense; GGGATATTCTTCAGCTACGAGCTCT
>probe:Drosophila_2:1636544_at:210:419; Interrogation_Position=1087; Antisense; GAGCTCTCGCCACTGATGGTGAAAT
>probe:Drosophila_2:1636544_at:75:427; Interrogation_Position=1117; Antisense; GAGAGACACAGCTCATTTGGCCACT
>probe:Drosophila_2:1636544_at:442:363; Interrogation_Position=1149; Antisense; GAATTGCTGTTCCATCATCGGAGGC
>probe:Drosophila_2:1636544_at:383:305; Interrogation_Position=1199; Antisense; CCGTGCTGCTGAACAACTCGTGGGA
>probe:Drosophila_2:1636544_at:315:643; Interrogation_Position=1278; Antisense; TCTTATGCAGCTTTACTACGCCTAA
>probe:Drosophila_2:1636544_at:124:95; Interrogation_Position=791; Antisense; AGTTCCACATCCATGACTTTCAGTT
>probe:Drosophila_2:1636544_at:679:377; Interrogation_Position=825; Antisense; GAAGCTATCGCACACAATCAATCAC
>probe:Drosophila_2:1636544_at:724:239; Interrogation_Position=840; Antisense; AATCAATCACCTATCGTTCGGCGAG
>probe:Drosophila_2:1636544_at:502:457; Interrogation_Position=867; Antisense; GATAGAGTTCGCCAAGACGCATCCC
>probe:Drosophila_2:1636544_at:506:557; Interrogation_Position=898; Antisense; GGACTACGAGTCGACGTGGCTGAAA
>probe:Drosophila_2:1636544_at:534:575; Interrogation_Position=991; Antisense; GGCGAGCCCATATACACGAATCAAT

Paste this into a BLAST search page for me
ACGAATCAATTCTCCGTCACGCGATAGATCTTTCAGATCGCGAGCGCGGAGGGATATTCTTCAGCTACGAGCTCTGAGCTCTCGCCACTGATGGTGAAATGAGAGACACAGCTCATTTGGCCACTGAATTGCTGTTCCATCATCGGAGGCCCGTGCTGCTGAACAACTCGTGGGATCTTATGCAGCTTTACTACGCCTAAAGTTCCACATCCATGACTTTCAGTTGAAGCTATCGCACACAATCAATCACAATCAATCACCTATCGTTCGGCGAGGATAGAGTTCGCCAAGACGCATCCCGGACTACGAGTCGACGTGGCTGAAAGGCGAGCCCATATACACGAATCAAT

Full Affymetrix probeset data:

Annotations for 1636544_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime