FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636545_at:

>probe:Drosophila_2:1636545_at:452:629; Interrogation_Position=123; Antisense; TCCTGGTTCTGTTGGTCTCAATGAA
>probe:Drosophila_2:1636545_at:384:59; Interrogation_Position=13; Antisense; ATGTTTGCTACTCTGCTGATTCTCA
>probe:Drosophila_2:1636545_at:65:233; Interrogation_Position=142; Antisense; AATGAAGCCTTCGACGCTAGGATGA
>probe:Drosophila_2:1636545_at:85:545; Interrogation_Position=161; Antisense; GGATGAGTGTGCTCCACTTTAACCG
>probe:Drosophila_2:1636545_at:197:123; Interrogation_Position=197; Antisense; AGCCGACCGTATTTAACACTCTGAC
>probe:Drosophila_2:1636545_at:402:715; Interrogation_Position=229; Antisense; TTCTGCGACGCAATGTTCAATCCGA
>probe:Drosophila_2:1636545_at:419:213; Interrogation_Position=308; Antisense; AAGAGAAGTGCCTCGCTACGCAAGG
>probe:Drosophila_2:1636545_at:495:593; Interrogation_Position=360; Antisense; TGTGGTTCCCCGACTAAATAACGTG
>probe:Drosophila_2:1636545_at:586:599; Interrogation_Position=383; Antisense; TGTTGGGACCCACTCTCAAAGGACG
>probe:Drosophila_2:1636545_at:209:587; Interrogation_Position=416; Antisense; TGGTTTTCCTGTTCGAAGCCTTCAA
>probe:Drosophila_2:1636545_at:626:531; Interrogation_Position=43; Antisense; GGGTCGACTGACATTTTGGCCACAG
>probe:Drosophila_2:1636545_at:678:385; Interrogation_Position=442; Antisense; GAACAGGACGAACGGCAGCCTTCAT
>probe:Drosophila_2:1636545_at:506:125; Interrogation_Position=458; Antisense; AGCCTTCATCCGTGTGCTTCGAGAT
>probe:Drosophila_2:1636545_at:363:501; Interrogation_Position=82; Antisense; GTCGAGGATCCAGACATCTACACGC

Paste this into a BLAST search page for me
TCCTGGTTCTGTTGGTCTCAATGAAATGTTTGCTACTCTGCTGATTCTCAAATGAAGCCTTCGACGCTAGGATGAGGATGAGTGTGCTCCACTTTAACCGAGCCGACCGTATTTAACACTCTGACTTCTGCGACGCAATGTTCAATCCGAAAGAGAAGTGCCTCGCTACGCAAGGTGTGGTTCCCCGACTAAATAACGTGTGTTGGGACCCACTCTCAAAGGACGTGGTTTTCCTGTTCGAAGCCTTCAAGGGTCGACTGACATTTTGGCCACAGGAACAGGACGAACGGCAGCCTTCATAGCCTTCATCCGTGTGCTTCGAGATGTCGAGGATCCAGACATCTACACGC

Full Affymetrix probeset data:

Annotations for 1636545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720