FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636548_at:

>probe:Drosophila_2:1636548_at:685:633; Interrogation_Position=1736; Antisense; TCGCCAAGGACGGTGCTATCTCGGA
>probe:Drosophila_2:1636548_at:1:313; Interrogation_Position=1771; Antisense; GCCAAGCTGAAGGACATTGTTGCCA
>probe:Drosophila_2:1636548_at:56:61; Interrogation_Position=1801; Antisense; ATGTCCACCTTCCAGGGTTAAGCAT
>probe:Drosophila_2:1636548_at:71:331; Interrogation_Position=1851; Antisense; GCGGTGCGTGCAATTAACATCATAG
>probe:Drosophila_2:1636548_at:105:573; Interrogation_Position=1878; Antisense; GGCTCGAATAATGCTGCCATCCCTG
>probe:Drosophila_2:1636548_at:641:423; Interrogation_Position=1971; Antisense; GAGAAAACTCCTTTGCACATTCATG
>probe:Drosophila_2:1636548_at:278:723; Interrogation_Position=1983; Antisense; TTGCACATTCATGTTTTCCTGCGCA
>probe:Drosophila_2:1636548_at:401:623; Interrogation_Position=2002; Antisense; TGCGCATCCTGACTGGATCGATCGC
>probe:Drosophila_2:1636548_at:362:451; Interrogation_Position=2017; Antisense; GATCGATCGCCTTCAATCCGTGGTT
>probe:Drosophila_2:1636548_at:634:471; Interrogation_Position=2039; Antisense; GTTCGGTGCCATTATGCCGCAAAAT
>probe:Drosophila_2:1636548_at:673:123; Interrogation_Position=2113; Antisense; AGCCGGATGCACTTTCGAGTTTCAG
>probe:Drosophila_2:1636548_at:622:135; Interrogation_Position=2135; Antisense; CAGCGAAAAATCCTTGCGGTTCCTC
>probe:Drosophila_2:1636548_at:430:629; Interrogation_Position=2155; Antisense; TCCTCCAACCTCCAAAACGATAGAT
>probe:Drosophila_2:1636548_at:31:305; Interrogation_Position=2186; Antisense; CCGTTGTTCTTCTACCTAAAATATG

Paste this into a BLAST search page for me
TCGCCAAGGACGGTGCTATCTCGGAGCCAAGCTGAAGGACATTGTTGCCAATGTCCACCTTCCAGGGTTAAGCATGCGGTGCGTGCAATTAACATCATAGGGCTCGAATAATGCTGCCATCCCTGGAGAAAACTCCTTTGCACATTCATGTTGCACATTCATGTTTTCCTGCGCATGCGCATCCTGACTGGATCGATCGCGATCGATCGCCTTCAATCCGTGGTTGTTCGGTGCCATTATGCCGCAAAATAGCCGGATGCACTTTCGAGTTTCAGCAGCGAAAAATCCTTGCGGTTCCTCTCCTCCAACCTCCAAAACGATAGATCCGTTGTTCTTCTACCTAAAATATG

Full Affymetrix probeset data:

Annotations for 1636548_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720