FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636549_at:

>probe:Drosophila_2:1636549_at:627:377; Interrogation_Position=8780; Antisense; GAAGCAGATCGAGCGGCAGACCCAC
>probe:Drosophila_2:1636549_at:72:363; Interrogation_Position=8865; Antisense; GAATTGTGCAGCACCTCAGGCACAT
>probe:Drosophila_2:1636549_at:711:11; Interrogation_Position=8924; Antisense; ATTCATGTCCAGCAGCTATGCAGGC
>probe:Drosophila_2:1636549_at:196:289; Interrogation_Position=8968; Antisense; CGGCCAGCAACTTTTCCTATTTGAA
>probe:Drosophila_2:1636549_at:364:529; Interrogation_Position=9008; Antisense; GGGTTCGGGCATCTCGTCAATTTCG
>probe:Drosophila_2:1636549_at:239:681; Interrogation_Position=9114; Antisense; TATGTACCCTACAATTTCACCAGCT
>probe:Drosophila_2:1636549_at:12:315; Interrogation_Position=9136; Antisense; GCTCTTTCACATCTCGCTTAAACGA
>probe:Drosophila_2:1636549_at:438:15; Interrogation_Position=9165; Antisense; ATTATCACTTCCACTACCAGTGCAG
>probe:Drosophila_2:1636549_at:33:511; Interrogation_Position=9184; Antisense; GTGCAGTTAGCACTAGTTCCCTTAC
>probe:Drosophila_2:1636549_at:617:235; Interrogation_Position=9228; Antisense; AATCCCATGATGTCGTTCACACTGA
>probe:Drosophila_2:1636549_at:483:285; Interrogation_Position=9249; Antisense; CTGAGGGAACCACTAGCCAGCAGTT
>probe:Drosophila_2:1636549_at:535:91; Interrogation_Position=9270; Antisense; AGTTCCCTGGGTGGTTCAAGTGCCT
>probe:Drosophila_2:1636549_at:116:643; Interrogation_Position=9294; Antisense; TCTCCATTGCTACCGTTTCAGTTTA
>probe:Drosophila_2:1636549_at:587:191; Interrogation_Position=9323; Antisense; AACTTTCACTTCCAACTTCGACAAG

Paste this into a BLAST search page for me
GAAGCAGATCGAGCGGCAGACCCACGAATTGTGCAGCACCTCAGGCACATATTCATGTCCAGCAGCTATGCAGGCCGGCCAGCAACTTTTCCTATTTGAAGGGTTCGGGCATCTCGTCAATTTCGTATGTACCCTACAATTTCACCAGCTGCTCTTTCACATCTCGCTTAAACGAATTATCACTTCCACTACCAGTGCAGGTGCAGTTAGCACTAGTTCCCTTACAATCCCATGATGTCGTTCACACTGACTGAGGGAACCACTAGCCAGCAGTTAGTTCCCTGGGTGGTTCAAGTGCCTTCTCCATTGCTACCGTTTCAGTTTAAACTTTCACTTCCAACTTCGACAAG

Full Affymetrix probeset data:

Annotations for 1636549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720