Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636550_at:

>probe:Drosophila_2:1636550_at:382:51; Interrogation_Position=13; Antisense; ATGCGAGTGTTGCTGGCTTTTGTAC
>probe:Drosophila_2:1636550_at:627:567; Interrogation_Position=132; Antisense; GGCACTGGACCTTTTAATGAGCTAT
>probe:Drosophila_2:1636550_at:488:175; Interrogation_Position=170; Antisense; AAACCCACAACGTCATGTGCTTCAT
>probe:Drosophila_2:1636550_at:395:597; Interrogation_Position=185; Antisense; TGTGCTTCATCAACTGCATCTTCGA
>probe:Drosophila_2:1636550_at:46:37; Interrogation_Position=202; Antisense; ATCTTCGAGCGAACCAACATACTGC
>probe:Drosophila_2:1636550_at:698:387; Interrogation_Position=253; Antisense; GAAAATCACAACTGCGACTCCATCA
>probe:Drosophila_2:1636550_at:247:623; Interrogation_Position=265; Antisense; TGCGACTCCATCAAGGACGCTGATA
>probe:Drosophila_2:1636550_at:618:325; Interrogation_Position=283; Antisense; GCTGATAAGTGTGCAGAATCCTTCC
>probe:Drosophila_2:1636550_at:374:691; Interrogation_Position=31; Antisense; TTTGTACTTCTGCTTGGCCTCTCAG
>probe:Drosophila_2:1636550_at:435:175; Interrogation_Position=340; Antisense; AAACGTGATAGTGCAGCAACGCGAC
>probe:Drosophila_2:1636550_at:554:351; Interrogation_Position=352; Antisense; GCAGCAACGCGACATGTGCCACAAA
>probe:Drosophila_2:1636550_at:663:505; Interrogation_Position=367; Antisense; GTGCCACAAACAATGCCCAAACTTT
>probe:Drosophila_2:1636550_at:179:315; Interrogation_Position=47; Antisense; GCCTCTCAGTTTTGGCCACTAAGGA
>probe:Drosophila_2:1636550_at:117:599; Interrogation_Position=90; Antisense; TGTAAGCGAGTGTGCCAAGGAGAAC

Paste this into a BLAST search page for me
ATGCGAGTGTTGCTGGCTTTTGTACGGCACTGGACCTTTTAATGAGCTATAAACCCACAACGTCATGTGCTTCATTGTGCTTCATCAACTGCATCTTCGAATCTTCGAGCGAACCAACATACTGCGAAAATCACAACTGCGACTCCATCATGCGACTCCATCAAGGACGCTGATAGCTGATAAGTGTGCAGAATCCTTCCTTTGTACTTCTGCTTGGCCTCTCAGAAACGTGATAGTGCAGCAACGCGACGCAGCAACGCGACATGTGCCACAAAGTGCCACAAACAATGCCCAAACTTTGCCTCTCAGTTTTGGCCACTAAGGATGTAAGCGAGTGTGCCAAGGAGAAC

Full Affymetrix probeset data:

Annotations for 1636550_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime