FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636551_at:

>probe:Drosophila_2:1636551_at:10:325; Interrogation_Position=1014; Antisense; GCGCAACGCCCTCTTTAAAATCGAG
>probe:Drosophila_2:1636551_at:408:77; Interrogation_Position=1094; Antisense; AGGATAAGCTTCGACGACCGGCACA
>probe:Drosophila_2:1636551_at:206:253; Interrogation_Position=1138; Antisense; CAAGCCATCCGCATATTTGTGAACA
>probe:Drosophila_2:1636551_at:704:5; Interrogation_Position=1177; Antisense; ATCAACTACGGTATGGTTTTGGCCA
>probe:Drosophila_2:1636551_at:99:165; Interrogation_Position=1205; Antisense; AAATCCTCCGTGTGGATGGACGCTT
>probe:Drosophila_2:1636551_at:576:65; Interrogation_Position=1220; Antisense; ATGGACGCTTGGTGACCATTACCTT
>probe:Drosophila_2:1636551_at:522:145; Interrogation_Position=1247; Antisense; ACTCGCTGGAGGACACTATCGTGAA
>probe:Drosophila_2:1636551_at:726:31; Interrogation_Position=1279; Antisense; ATCAACGGAAACGTCCTGGCAGGCG
>probe:Drosophila_2:1636551_at:51:219; Interrogation_Position=1324; Antisense; AAGTACTCCAGCCATTATGCAATAG
>probe:Drosophila_2:1636551_at:413:667; Interrogation_Position=1397; Antisense; TACATCGCCATGTCATTGTGCCAGA
>probe:Drosophila_2:1636551_at:115:523; Interrogation_Position=1432; Antisense; GTGGCGAGGAACACACGCAGTCGAT
>probe:Drosophila_2:1636551_at:190:89; Interrogation_Position=1450; Antisense; AGTCGATCCGCCAAGCTGAGAGCAG
>probe:Drosophila_2:1636551_at:54:345; Interrogation_Position=1494; Antisense; GCATGTCAATAAATTCCCTCGGTCT
>probe:Drosophila_2:1636551_at:515:265; Interrogation_Position=996; Antisense; CAGAGGACTGGTAGACGCGCGCAAC

Paste this into a BLAST search page for me
GCGCAACGCCCTCTTTAAAATCGAGAGGATAAGCTTCGACGACCGGCACACAAGCCATCCGCATATTTGTGAACAATCAACTACGGTATGGTTTTGGCCAAAATCCTCCGTGTGGATGGACGCTTATGGACGCTTGGTGACCATTACCTTACTCGCTGGAGGACACTATCGTGAAATCAACGGAAACGTCCTGGCAGGCGAAGTACTCCAGCCATTATGCAATAGTACATCGCCATGTCATTGTGCCAGAGTGGCGAGGAACACACGCAGTCGATAGTCGATCCGCCAAGCTGAGAGCAGGCATGTCAATAAATTCCCTCGGTCTCAGAGGACTGGTAGACGCGCGCAAC

Full Affymetrix probeset data:

Annotations for 1636551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720