FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636552_at:

>probe:Drosophila_2:1636552_at:4:593; Interrogation_Position=138; Antisense; TGGTGACGACGAACCGCCGTTGAAA
>probe:Drosophila_2:1636552_at:598:391; Interrogation_Position=187; Antisense; GAAACCTCGATGAAACCTCGGCGAC
>probe:Drosophila_2:1636552_at:332:411; Interrogation_Position=212; Antisense; GACGCAGAACAGACGCCAGACAGTT
>probe:Drosophila_2:1636552_at:410:15; Interrogation_Position=22; Antisense; ATTAGTGACCGACCAGCAAAGCTTG
>probe:Drosophila_2:1636552_at:388:91; Interrogation_Position=233; Antisense; AGTTGGATTTCACACACAGGCCCAC
>probe:Drosophila_2:1636552_at:112:335; Interrogation_Position=306; Antisense; GCTGTTGCCGAGATCTTTTGGTGAT
>probe:Drosophila_2:1636552_at:233:333; Interrogation_Position=347; Antisense; GCTGTTTTGTACGTGTTCTGTTGCA
>probe:Drosophila_2:1636552_at:396:141; Interrogation_Position=377; Antisense; ACGGTAGCCATTGTGCTGCACACAG
>probe:Drosophila_2:1636552_at:723:585; Interrogation_Position=45; Antisense; TGGAAATACCCAGCGATCAGAGATC
>probe:Drosophila_2:1636552_at:447:729; Interrogation_Position=451; Antisense; TTGGTGGCGATGATGTTGCCCCAGT
>probe:Drosophila_2:1636552_at:190:467; Interrogation_Position=480; Antisense; GTTGTTTCTGTTGGTGCCGGAGTAC
>probe:Drosophila_2:1636552_at:701:301; Interrogation_Position=496; Antisense; CCGGAGTACTCGAGGCTTTTGTCAA
>probe:Drosophila_2:1636552_at:463:571; Interrogation_Position=509; Antisense; GGCTTTTGTCAATTGCTATGGCACA
>probe:Drosophila_2:1636552_at:631:441; Interrogation_Position=87; Antisense; GATGGGATATCTGCCATGGCGGCCA

Paste this into a BLAST search page for me
TGGTGACGACGAACCGCCGTTGAAAGAAACCTCGATGAAACCTCGGCGACGACGCAGAACAGACGCCAGACAGTTATTAGTGACCGACCAGCAAAGCTTGAGTTGGATTTCACACACAGGCCCACGCTGTTGCCGAGATCTTTTGGTGATGCTGTTTTGTACGTGTTCTGTTGCAACGGTAGCCATTGTGCTGCACACAGTGGAAATACCCAGCGATCAGAGATCTTGGTGGCGATGATGTTGCCCCAGTGTTGTTTCTGTTGGTGCCGGAGTACCCGGAGTACTCGAGGCTTTTGTCAAGGCTTTTGTCAATTGCTATGGCACAGATGGGATATCTGCCATGGCGGCCA

Full Affymetrix probeset data:

Annotations for 1636552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720