Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636553_at:

>probe:Drosophila_2:1636553_at:384:687; Interrogation_Position=100; Antisense; TATTACCCCGAGGAACCTCTGACGG
>probe:Drosophila_2:1636553_at:688:429; Interrogation_Position=163; Antisense; GAGTTTCTGCTATCCAATGTTCCCT
>probe:Drosophila_2:1636553_at:339:231; Interrogation_Position=178; Antisense; AATGTTCCCTTTGGCACATGCTTCG
>probe:Drosophila_2:1636553_at:423:713; Interrogation_Position=236; Antisense; TTGTGGCGGGACCAAAGGACTCCCA
>probe:Drosophila_2:1636553_at:672:617; Interrogation_Position=323; Antisense; TGCATCTGCTATCCGCCGTGGAGAC
>probe:Drosophila_2:1636553_at:538:441; Interrogation_Position=355; Antisense; GATGTGTGCCGTCGCTTCAGTGTAC
>probe:Drosophila_2:1636553_at:711:347; Interrogation_Position=390; Antisense; GCATGTTCATGCACTGGGCGTTGAT
>probe:Drosophila_2:1636553_at:83:639; Interrogation_Position=494; Antisense; TCGTATCCGTCGACTGTACCAGTGT
>probe:Drosophila_2:1636553_at:607:3; Interrogation_Position=531; Antisense; ATTGGTCCAGCGTCTGGGCTACCAG
>probe:Drosophila_2:1636553_at:579:523; Interrogation_Position=546; Antisense; GGGCTACCAGCTCATCAACACGTTG
>probe:Drosophila_2:1636553_at:343:139; Interrogation_Position=565; Antisense; ACGTTGCGGTACGTGGACCACCTGG
>probe:Drosophila_2:1636553_at:126:135; Interrogation_Position=590; Antisense; ACGCCAGTGGGCAGCAGGTCATACG
>probe:Drosophila_2:1636553_at:616:135; Interrogation_Position=629; Antisense; ACGAGAGTGTCCAGACCTTCGTGCT
>probe:Drosophila_2:1636553_at:130:197; Interrogation_Position=66; Antisense; AACGGAGCAACTGATGACCTTCCTG

Paste this into a BLAST search page for me
TATTACCCCGAGGAACCTCTGACGGGAGTTTCTGCTATCCAATGTTCCCTAATGTTCCCTTTGGCACATGCTTCGTTGTGGCGGGACCAAAGGACTCCCATGCATCTGCTATCCGCCGTGGAGACGATGTGTGCCGTCGCTTCAGTGTACGCATGTTCATGCACTGGGCGTTGATTCGTATCCGTCGACTGTACCAGTGTATTGGTCCAGCGTCTGGGCTACCAGGGGCTACCAGCTCATCAACACGTTGACGTTGCGGTACGTGGACCACCTGGACGCCAGTGGGCAGCAGGTCATACGACGAGAGTGTCCAGACCTTCGTGCTAACGGAGCAACTGATGACCTTCCTG

Full Affymetrix probeset data:

Annotations for 1636553_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime