FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636555_at:

>probe:Drosophila_2:1636555_at:206:31; Interrogation_Position=161; Antisense; ATAACAGCAGTCTTACCTCCTTGAG
>probe:Drosophila_2:1636555_at:154:493; Interrogation_Position=226; Antisense; GTCAAGTTAGTACCTAGCCTGGCGT
>probe:Drosophila_2:1636555_at:96:675; Interrogation_Position=240; Antisense; TAGCCTGGCGTATCCTGTGAAGCAG
>probe:Drosophila_2:1636555_at:492:115; Interrogation_Position=275; Antisense; AGCAGTCCTTTTGGTGGTTCTTCAA
>probe:Drosophila_2:1636555_at:407:541; Interrogation_Position=290; Antisense; GGTTCTTCAACTTGCAAGGCCAGTG
>probe:Drosophila_2:1636555_at:509:587; Interrogation_Position=343; Antisense; TGGAGCTTTTGGAACACCACCGCTT
>probe:Drosophila_2:1636555_at:22:439; Interrogation_Position=424; Antisense; GAGGCGCGCACATGGGTCTACAATG
>probe:Drosophila_2:1636555_at:421:329; Interrogation_Position=488; Antisense; GCGGAGTTTGCCTGCTCAGAAGCAT
>probe:Drosophila_2:1636555_at:444:395; Interrogation_Position=517; Antisense; GAAATCTCGCAGAAACCCTTTCAGA
>probe:Drosophila_2:1636555_at:247:493; Interrogation_Position=605; Antisense; GTAAGTATTTACATGCCCGTGACGC
>probe:Drosophila_2:1636555_at:36:407; Interrogation_Position=646; Antisense; GACTGCGAGCGAACCTATAGTGACT
>probe:Drosophila_2:1636555_at:643:685; Interrogation_Position=661; Antisense; TATAGTGACTGCAATCCGCTGCTCT
>probe:Drosophila_2:1636555_at:193:621; Interrogation_Position=680; Antisense; TGCTCTGGAGCCTCGTGACAAATAT
>probe:Drosophila_2:1636555_at:251:681; Interrogation_Position=702; Antisense; TATGGCCAAGAATCCGTTTCAGTGA

Paste this into a BLAST search page for me
ATAACAGCAGTCTTACCTCCTTGAGGTCAAGTTAGTACCTAGCCTGGCGTTAGCCTGGCGTATCCTGTGAAGCAGAGCAGTCCTTTTGGTGGTTCTTCAAGGTTCTTCAACTTGCAAGGCCAGTGTGGAGCTTTTGGAACACCACCGCTTGAGGCGCGCACATGGGTCTACAATGGCGGAGTTTGCCTGCTCAGAAGCATGAAATCTCGCAGAAACCCTTTCAGAGTAAGTATTTACATGCCCGTGACGCGACTGCGAGCGAACCTATAGTGACTTATAGTGACTGCAATCCGCTGCTCTTGCTCTGGAGCCTCGTGACAAATATTATGGCCAAGAATCCGTTTCAGTGA

Full Affymetrix probeset data:

Annotations for 1636555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720