Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636556_at:

>probe:Drosophila_2:1636556_at:273:99; Interrogation_Position=198; Antisense; AGATGACCTCTTGCCTGGAACTAGA
>probe:Drosophila_2:1636556_at:236:677; Interrogation_Position=219; Antisense; TAGACTTCGCTACCGTCGCAGGAAT
>probe:Drosophila_2:1636556_at:690:39; Interrogation_Position=248; Antisense; ATCTGGATCCCTATGTGTGCAATGA
>probe:Drosophila_2:1636556_at:597:533; Interrogation_Position=295; Antisense; GGTGTGATCACCATCTGTGGTCATT
>probe:Drosophila_2:1636556_at:474:311; Interrogation_Position=366; Antisense; GCCAAGATGTCCATGCTGTCAACGA
>probe:Drosophila_2:1636556_at:144:411; Interrogation_Position=434; Antisense; GACCCAATGCCCGTCAGGAGGATAA
>probe:Drosophila_2:1636556_at:679:77; Interrogation_Position=452; Antisense; AGGATAATAATGTGCCGGCCCAGCC
>probe:Drosophila_2:1636556_at:694:303; Interrogation_Position=493; Antisense; CCGACGGGACTGTATCTCTCTGATA
>probe:Drosophila_2:1636556_at:248:285; Interrogation_Position=512; Antisense; CTGATACTGATTTTCCCTGTTGGTT
>probe:Drosophila_2:1636556_at:411:471; Interrogation_Position=534; Antisense; GTTCGCGGTCAACGATCCTGTAGAT
>probe:Drosophila_2:1636556_at:374:425; Interrogation_Position=592; Antisense; GAGAGGGATCTTCACTGCGCTATAA
>probe:Drosophila_2:1636556_at:436:513; Interrogation_Position=631; Antisense; GTGTACCCTTGGATCGGAGCACAAA
>probe:Drosophila_2:1636556_at:671:545; Interrogation_Position=682; Antisense; GGATGCGTGTTGCTCATATTTCTGA
>probe:Drosophila_2:1636556_at:289:629; Interrogation_Position=712; Antisense; TCCGTACTGTCGCTGTTCTAAGAGG

Paste this into a BLAST search page for me
AGATGACCTCTTGCCTGGAACTAGATAGACTTCGCTACCGTCGCAGGAATATCTGGATCCCTATGTGTGCAATGAGGTGTGATCACCATCTGTGGTCATTGCCAAGATGTCCATGCTGTCAACGAGACCCAATGCCCGTCAGGAGGATAAAGGATAATAATGTGCCGGCCCAGCCCCGACGGGACTGTATCTCTCTGATACTGATACTGATTTTCCCTGTTGGTTGTTCGCGGTCAACGATCCTGTAGATGAGAGGGATCTTCACTGCGCTATAAGTGTACCCTTGGATCGGAGCACAAAGGATGCGTGTTGCTCATATTTCTGATCCGTACTGTCGCTGTTCTAAGAGG

Full Affymetrix probeset data:

Annotations for 1636556_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime