Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636559_s_at:

>probe:Drosophila_2:1636559_s_at:344:525; Interrogation_Position=1007; Antisense; GGGCTAATTTGTTTTGCTTTTCATA
>probe:Drosophila_2:1636559_s_at:375:455; Interrogation_Position=520; Antisense; GATAATGGCCAACATTGCCCACGAA
>probe:Drosophila_2:1636559_s_at:552:445; Interrogation_Position=574; Antisense; GATGCTGGCCGGTTACGATAAGCGT
>probe:Drosophila_2:1636559_s_at:245:139; Interrogation_Position=588; Antisense; ACGATAAGCGTGGTCCAGGCCTCTA
>probe:Drosophila_2:1636559_s_at:87:71; Interrogation_Position=604; Antisense; AGGCCTCTACTATGTGGACTCCGAG
>probe:Drosophila_2:1636559_s_at:76:135; Interrogation_Position=638; Antisense; ACGCCTGGCAATTTGTTCTCTGTTG
>probe:Drosophila_2:1636559_s_at:526:721; Interrogation_Position=660; Antisense; TTGGTAGTGGATCGCTGTACGCCTA
>probe:Drosophila_2:1636559_s_at:615:553; Interrogation_Position=694; Antisense; GGACTCTGGCTATCATTGGGACCTG
>probe:Drosophila_2:1636559_s_at:638:75; Interrogation_Position=735; Antisense; AGGAGCTGGGACGTCGCGCCATCTA
>probe:Drosophila_2:1636559_s_at:199:37; Interrogation_Position=755; Antisense; ATCTACCATGCCACCTTCAGGGATG
>probe:Drosophila_2:1636559_s_at:575:143; Interrogation_Position=783; Antisense; ACTCCGGTGGTATCATTCGCGTGTA
>probe:Drosophila_2:1636559_s_at:210:187; Interrogation_Position=842; Antisense; AACACCGACTGCATGGAGCTGCACT
>probe:Drosophila_2:1636559_s_at:283:553; Interrogation_Position=856; Antisense; GGAGCTGCACTACATGTACCAGGAG
>probe:Drosophila_2:1636559_s_at:250:353; Interrogation_Position=889; Antisense; GCAGCAGGCCGCTAAGTAGAGTTTT

Paste this into a BLAST search page for me
GGGCTAATTTGTTTTGCTTTTCATAGATAATGGCCAACATTGCCCACGAAGATGCTGGCCGGTTACGATAAGCGTACGATAAGCGTGGTCCAGGCCTCTAAGGCCTCTACTATGTGGACTCCGAGACGCCTGGCAATTTGTTCTCTGTTGTTGGTAGTGGATCGCTGTACGCCTAGGACTCTGGCTATCATTGGGACCTGAGGAGCTGGGACGTCGCGCCATCTAATCTACCATGCCACCTTCAGGGATGACTCCGGTGGTATCATTCGCGTGTAAACACCGACTGCATGGAGCTGCACTGGAGCTGCACTACATGTACCAGGAGGCAGCAGGCCGCTAAGTAGAGTTTT

Full Affymetrix probeset data:

Annotations for 1636559_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime