Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636561_at:

>probe:Drosophila_2:1636561_at:471:125; Interrogation_Position=1105; Antisense; AGCCGTGGCACGACTTTTGGGACGA
>probe:Drosophila_2:1636561_at:51:557; Interrogation_Position=1124; Antisense; GGACGAGGTCCTGCAGCAGATCTGC
>probe:Drosophila_2:1636561_at:415:549; Interrogation_Position=1184; Antisense; GGAGGAGAGCCACAACTGCTACGCC
>probe:Drosophila_2:1636561_at:637:111; Interrogation_Position=1266; Antisense; AGCAAGACCGCCTTCTGTGAGCAGT
>probe:Drosophila_2:1636561_at:491:595; Interrogation_Position=1281; Antisense; TGTGAGCAGTGCATTGTTCCAAGGA
>probe:Drosophila_2:1636561_at:401:469; Interrogation_Position=1296; Antisense; GTTCCAAGGACGACGACAGCGGGCA
>probe:Drosophila_2:1636561_at:419:121; Interrogation_Position=1313; Antisense; AGCGGGCAAGTACATCTCGCTGTAT
>probe:Drosophila_2:1636561_at:337:39; Interrogation_Position=1326; Antisense; ATCTCGCTGTATCGCAAAATCCGCA
>probe:Drosophila_2:1636561_at:317:349; Interrogation_Position=1348; Antisense; GCAGGAGCGGCATCTACGTCCATCG
>probe:Drosophila_2:1636561_at:724:43; Interrogation_Position=1369; Antisense; ATCGCCAGCAGCCTAAAAACCGCAG
>probe:Drosophila_2:1636561_at:435:181; Interrogation_Position=1383; Antisense; AAAAACCGCAGTAAGCCAGCATCCG
>probe:Drosophila_2:1636561_at:300:105; Interrogation_Position=1433; Antisense; AGACTCGTGCGATGGCCTTGGCAGC
>probe:Drosophila_2:1636561_at:686:91; Interrogation_Position=1494; Antisense; AGTATTACAGGACTTGCCAACCGCC
>probe:Drosophila_2:1636561_at:69:261; Interrogation_Position=1526; Antisense; CACGCTCTGCACCATCGAAGAGTAA

Paste this into a BLAST search page for me
AGCCGTGGCACGACTTTTGGGACGAGGACGAGGTCCTGCAGCAGATCTGCGGAGGAGAGCCACAACTGCTACGCCAGCAAGACCGCCTTCTGTGAGCAGTTGTGAGCAGTGCATTGTTCCAAGGAGTTCCAAGGACGACGACAGCGGGCAAGCGGGCAAGTACATCTCGCTGTATATCTCGCTGTATCGCAAAATCCGCAGCAGGAGCGGCATCTACGTCCATCGATCGCCAGCAGCCTAAAAACCGCAGAAAAACCGCAGTAAGCCAGCATCCGAGACTCGTGCGATGGCCTTGGCAGCAGTATTACAGGACTTGCCAACCGCCCACGCTCTGCACCATCGAAGAGTAA

Full Affymetrix probeset data:

Annotations for 1636561_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime