FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636566_at:

>probe:Drosophila_2:1636566_at:98:47; Interrogation_Position=105; Antisense; ATCCGACAAGGAGAAGAGGCAATTT
>probe:Drosophila_2:1636566_at:278:273; Interrogation_Position=13; Antisense; CATTCAGTCAATACACATCGTGCAA
>probe:Drosophila_2:1636566_at:500:283; Interrogation_Position=133; Antisense; CTGAAAATTATGGAGCTCGAGCACG
>probe:Drosophila_2:1636566_at:22:561; Interrogation_Position=168; Antisense; GGAAAAGGATCCAGCTCGCGCCAAG
>probe:Drosophila_2:1636566_at:603:309; Interrogation_Position=178; Antisense; CCAGCTCGCGCCAAGATGATCGAGG
>probe:Drosophila_2:1636566_at:25:255; Interrogation_Position=241; Antisense; CAAAAGCGGAACTTGGAAATTGCCA
>probe:Drosophila_2:1636566_at:690:7; Interrogation_Position=259; Antisense; ATTGCCAAGGCAAACGTGATGTTAA
>probe:Drosophila_2:1636566_at:653:269; Interrogation_Position=28; Antisense; CATCGTGCAAAGACAACTTGATATC
>probe:Drosophila_2:1636566_at:236:7; Interrogation_Position=343; Antisense; ATTGCTTCCAATAATGAATCCCGGC
>probe:Drosophila_2:1636566_at:173:367; Interrogation_Position=358; Antisense; GAATCCCGGCAAGGCAAAGCTGCTT
>probe:Drosophila_2:1636566_at:51:73; Interrogation_Position=369; Antisense; AGGCAAAGCTGCTTGCAGTTTTGAT
>probe:Drosophila_2:1636566_at:665:149; Interrogation_Position=43; Antisense; ACTTGATATCAATCGCTGCATACAA
>probe:Drosophila_2:1636566_at:653:547; Interrogation_Position=72; Antisense; GGATGGTGCCATTGCAATGAATCAT
>probe:Drosophila_2:1636566_at:38:615; Interrogation_Position=89; Antisense; TGAATCATGTGGTGGAATCCGACAA

Paste this into a BLAST search page for me
ATCCGACAAGGAGAAGAGGCAATTTCATTCAGTCAATACACATCGTGCAACTGAAAATTATGGAGCTCGAGCACGGGAAAAGGATCCAGCTCGCGCCAAGCCAGCTCGCGCCAAGATGATCGAGGCAAAAGCGGAACTTGGAAATTGCCAATTGCCAAGGCAAACGTGATGTTAACATCGTGCAAAGACAACTTGATATCATTGCTTCCAATAATGAATCCCGGCGAATCCCGGCAAGGCAAAGCTGCTTAGGCAAAGCTGCTTGCAGTTTTGATACTTGATATCAATCGCTGCATACAAGGATGGTGCCATTGCAATGAATCATTGAATCATGTGGTGGAATCCGACAA

Full Affymetrix probeset data:

Annotations for 1636566_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720