FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636567_at:

>probe:Drosophila_2:1636567_at:659:157; Interrogation_Position=430; Antisense; ACAACAAGAGTGCTCCGGTCGGAGT
>probe:Drosophila_2:1636567_at:615:177; Interrogation_Position=466; Antisense; AAACGGATGGCTATTGCGTGCGTCC
>probe:Drosophila_2:1636567_at:134:709; Interrogation_Position=549; Antisense; TTAAAGAACTCCCTGGCGGTGCTGA
>probe:Drosophila_2:1636567_at:508:493; Interrogation_Position=606; Antisense; GTAATGCCAATTTGCATGCCACCTC
>probe:Drosophila_2:1636567_at:518:411; Interrogation_Position=647; Antisense; GACCCTGGTTGCTCAGACGTTTGTA
>probe:Drosophila_2:1636567_at:178:679; Interrogation_Position=670; Antisense; TAGTAGCTGGTCTTCGCGTCTTTGA
>probe:Drosophila_2:1636567_at:246:167; Interrogation_Position=707; Antisense; AAAGACCTGGGTAAACACGCTGAGT
>probe:Drosophila_2:1636567_at:186:607; Interrogation_Position=727; Antisense; TGAGTCGCGGCTTCTGTCAATCGAA
>probe:Drosophila_2:1636567_at:589:111; Interrogation_Position=774; Antisense; AGCAACACGGTTTGTGGCTACCACA
>probe:Drosophila_2:1636567_at:182:487; Interrogation_Position=807; Antisense; GTAGCTTATTACTTGGGCGCACCTC
>probe:Drosophila_2:1636567_at:135:37; Interrogation_Position=885; Antisense; ATCATGATCGACTGGCGCTGGGAGA
>probe:Drosophila_2:1636567_at:556:107; Interrogation_Position=907; Antisense; AGAACAACCGCATCATGTCCAGCTT
>probe:Drosophila_2:1636567_at:478:193; Interrogation_Position=975; Antisense; AACTCACTGATTGTACGCTCCTGAA
>probe:Drosophila_2:1636567_at:42:489; Interrogation_Position=987; Antisense; GTACGCTCCTGAACCTCGAATAAAG

Paste this into a BLAST search page for me
ACAACAAGAGTGCTCCGGTCGGAGTAAACGGATGGCTATTGCGTGCGTCCTTAAAGAACTCCCTGGCGGTGCTGAGTAATGCCAATTTGCATGCCACCTCGACCCTGGTTGCTCAGACGTTTGTATAGTAGCTGGTCTTCGCGTCTTTGAAAAGACCTGGGTAAACACGCTGAGTTGAGTCGCGGCTTCTGTCAATCGAAAGCAACACGGTTTGTGGCTACCACAGTAGCTTATTACTTGGGCGCACCTCATCATGATCGACTGGCGCTGGGAGAAGAACAACCGCATCATGTCCAGCTTAACTCACTGATTGTACGCTCCTGAAGTACGCTCCTGAACCTCGAATAAAG

Full Affymetrix probeset data:

Annotations for 1636567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720