FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636570_at:

>probe:Drosophila_2:1636570_at:303:599; Interrogation_Position=139; Antisense; TGTCCCGGCAAAGTGGTTTGCTGCT
>probe:Drosophila_2:1636570_at:418:625; Interrogation_Position=172; Antisense; TGCGCCTGCAAGATGCTCCTGAGCA
>probe:Drosophila_2:1636570_at:438:629; Interrogation_Position=188; Antisense; TCCTGAGCATCGTGTTTTCTGCGCT
>probe:Drosophila_2:1636570_at:554:641; Interrogation_Position=205; Antisense; TCTGCGCTCCTGATGGTCGTGGTGA
>probe:Drosophila_2:1636570_at:671:451; Interrogation_Position=228; Antisense; GATCGGCTTGATTGTCTACTTCACG
>probe:Drosophila_2:1636570_at:188:149; Interrogation_Position=245; Antisense; ACTTCACGGTCTTCTATCACAAGGA
>probe:Drosophila_2:1636570_at:674:509; Interrogation_Position=286; Antisense; GTGCAGAAGCAGGTCGCCCAACTGA
>probe:Drosophila_2:1636570_at:703:609; Interrogation_Position=308; Antisense; TGACGCCCATTGTGAAGCGCAGCAT
>probe:Drosophila_2:1636570_at:530:115; Interrogation_Position=328; Antisense; AGCATACGCGACTACTTCAACAAGG
>probe:Drosophila_2:1636570_at:309:127; Interrogation_Position=436; Antisense; ACCAAAGCCGTTCAGTGCATGACTT
>probe:Drosophila_2:1636570_at:367:403; Interrogation_Position=456; Antisense; GACTTAATCTAATCGCGTCGGATGC
>probe:Drosophila_2:1636570_at:568:291; Interrogation_Position=471; Antisense; CGTCGGATGCTCGTTATGGGATTTT
>probe:Drosophila_2:1636570_at:287:565; Interrogation_Position=532; Antisense; GGCAATTTGTGCGTTCTTTAGAAAG
>probe:Drosophila_2:1636570_at:38:229; Interrogation_Position=581; Antisense; AATGTGACTCACTGTATACCTTACA

Paste this into a BLAST search page for me
TGTCCCGGCAAAGTGGTTTGCTGCTTGCGCCTGCAAGATGCTCCTGAGCATCCTGAGCATCGTGTTTTCTGCGCTTCTGCGCTCCTGATGGTCGTGGTGAGATCGGCTTGATTGTCTACTTCACGACTTCACGGTCTTCTATCACAAGGAGTGCAGAAGCAGGTCGCCCAACTGATGACGCCCATTGTGAAGCGCAGCATAGCATACGCGACTACTTCAACAAGGACCAAAGCCGTTCAGTGCATGACTTGACTTAATCTAATCGCGTCGGATGCCGTCGGATGCTCGTTATGGGATTTTGGCAATTTGTGCGTTCTTTAGAAAGAATGTGACTCACTGTATACCTTACA

Full Affymetrix probeset data:

Annotations for 1636570_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720