FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636571_at:

>probe:Drosophila_2:1636571_at:526:63; Interrogation_Position=105; Antisense; ATGTGATGGTCCACTCGGTGATCAG
>probe:Drosophila_2:1636571_at:472:529; Interrogation_Position=146; Antisense; GGGATCACAGTTCTCATAGCAGCTA
>probe:Drosophila_2:1636571_at:239:27; Interrogation_Position=161; Antisense; ATAGCAGCTATTGGCCATCGCCTTT
>probe:Drosophila_2:1636571_at:250:35; Interrogation_Position=177; Antisense; ATCGCCTTTTGGTACAGTTCTGGAG
>probe:Drosophila_2:1636571_at:228:649; Interrogation_Position=229; Antisense; TCAGATCTTACGTTTCTATCCTCAC
>probe:Drosophila_2:1636571_at:92:551; Interrogation_Position=277; Antisense; GGAGACTCTTTATCTGGCCGGGAAA
>probe:Drosophila_2:1636571_at:183:377; Interrogation_Position=31; Antisense; GAAGAACCTGTTGTTATGGCGCAAT
>probe:Drosophila_2:1636571_at:236:723; Interrogation_Position=374; Antisense; TTGAAGTTCCTAGTTTTGCTCTGCG
>probe:Drosophila_2:1636571_at:172:623; Interrogation_Position=395; Antisense; TGCGGCATCAATTTGCTGGGCGATT
>probe:Drosophila_2:1636571_at:198:433; Interrogation_Position=412; Antisense; GGGCGATTGCTTCAACGGATTGACT
>probe:Drosophila_2:1636571_at:375:509; Interrogation_Position=454; Antisense; GTGCATATGTTGTCTTACTTTACTT
>probe:Drosophila_2:1636571_at:204:577; Interrogation_Position=48; Antisense; GGCGCAATAGCCGAAAGACTTTGAT
>probe:Drosophila_2:1636571_at:85:105; Interrogation_Position=63; Antisense; AGACTTTGATCGTCTTCACGGGCAT
>probe:Drosophila_2:1636571_at:352:621; Interrogation_Position=90; Antisense; TGCTCCTCCTGCTGGATGTGATGGT

Paste this into a BLAST search page for me
ATGTGATGGTCCACTCGGTGATCAGGGGATCACAGTTCTCATAGCAGCTAATAGCAGCTATTGGCCATCGCCTTTATCGCCTTTTGGTACAGTTCTGGAGTCAGATCTTACGTTTCTATCCTCACGGAGACTCTTTATCTGGCCGGGAAAGAAGAACCTGTTGTTATGGCGCAATTTGAAGTTCCTAGTTTTGCTCTGCGTGCGGCATCAATTTGCTGGGCGATTGGGCGATTGCTTCAACGGATTGACTGTGCATATGTTGTCTTACTTTACTTGGCGCAATAGCCGAAAGACTTTGATAGACTTTGATCGTCTTCACGGGCATTGCTCCTCCTGCTGGATGTGATGGT

Full Affymetrix probeset data:

Annotations for 1636571_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720