Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636572_at:

>probe:Drosophila_2:1636572_at:728:595; Interrogation_Position=4189; Antisense; TGTGAGAACCACTTCCAGCGACTGT
>probe:Drosophila_2:1636572_at:266:263; Interrogation_Position=4204; Antisense; CAGCGACTGTCGAAGACCTCGATAT
>probe:Drosophila_2:1636572_at:106:293; Interrogation_Position=4223; Antisense; CGATATTCACGGGTCTCAAGGCGGT
>probe:Drosophila_2:1636572_at:186:511; Interrogation_Position=4246; Antisense; GTGAATCACTTTGGTCGCCCAGATA
>probe:Drosophila_2:1636572_at:493:321; Interrogation_Position=4262; Antisense; GCCCAGATATGTCCAGCTTCTTGAA
>probe:Drosophila_2:1636572_at:443:377; Interrogation_Position=4299; Antisense; GAAGCACTCATACGTCTCCAAGATA
>probe:Drosophila_2:1636572_at:178:215; Interrogation_Position=4318; Antisense; AAGATAGGAGTCTTCTCCTGCGGTC
>probe:Drosophila_2:1636572_at:710:417; Interrogation_Position=4359; Antisense; GAGCGTGATGTCTGCCTGTGATGAA
>probe:Drosophila_2:1636572_at:364:213; Interrogation_Position=4390; Antisense; AAGACGCGCAAGTTGCCCTATTTCA
>probe:Drosophila_2:1636572_at:36:19; Interrogation_Position=4409; Antisense; ATTTCATCCACCACTTCGAGAACTT
>probe:Drosophila_2:1636572_at:249:81; Interrogation_Position=4439; Antisense; AGGTGTGCTGCGTTGGATGTATTCA
>probe:Drosophila_2:1636572_at:460:481; Interrogation_Position=4457; Antisense; GTATTCAAATTTTTCACCTGCCACC
>probe:Drosophila_2:1636572_at:54:93; Interrogation_Position=4552; Antisense; AGTTTTAGCGAATTCGGCTGCTCAA
>probe:Drosophila_2:1636572_at:378:717; Interrogation_Position=4564; Antisense; TTCGGCTGCTCAAACATACAACTTA

Paste this into a BLAST search page for me
TGTGAGAACCACTTCCAGCGACTGTCAGCGACTGTCGAAGACCTCGATATCGATATTCACGGGTCTCAAGGCGGTGTGAATCACTTTGGTCGCCCAGATAGCCCAGATATGTCCAGCTTCTTGAAGAAGCACTCATACGTCTCCAAGATAAAGATAGGAGTCTTCTCCTGCGGTCGAGCGTGATGTCTGCCTGTGATGAAAAGACGCGCAAGTTGCCCTATTTCAATTTCATCCACCACTTCGAGAACTTAGGTGTGCTGCGTTGGATGTATTCAGTATTCAAATTTTTCACCTGCCACCAGTTTTAGCGAATTCGGCTGCTCAATTCGGCTGCTCAAACATACAACTTA

Full Affymetrix probeset data:

Annotations for 1636572_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime