FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636580_at:

>probe:Drosophila_2:1636580_at:437:289; Interrogation_Position=2423; Antisense; CGGAGCACTCTGCAGTTCTGGAGAA
>probe:Drosophila_2:1636580_at:516:43; Interrogation_Position=2449; Antisense; ATCGAGCGCGAACTAGATGACCAGC
>probe:Drosophila_2:1636580_at:209:523; Interrogation_Position=2489; Antisense; GGGCCAATCGAGAGATCCGGACACA
>probe:Drosophila_2:1636580_at:1:707; Interrogation_Position=2540; Antisense; TTAGCGAGGAGTACCTGGCGCAGTT
>probe:Drosophila_2:1636580_at:642:93; Interrogation_Position=2561; Antisense; AGTTCGAGCGGGATCTGTCTCTACA
>probe:Drosophila_2:1636580_at:716:119; Interrogation_Position=2588; Antisense; AGCTGGAGGCGCGTAACACCAAGGC
>probe:Drosophila_2:1636580_at:576:227; Interrogation_Position=2608; Antisense; AAGGCGCTGAACATGATCACCGATC
>probe:Drosophila_2:1636580_at:80:455; Interrogation_Position=2622; Antisense; GATCACCGATCTGGCGAACAGCGAC
>probe:Drosophila_2:1636580_at:217:217; Interrogation_Position=2692; Antisense; AAGTTGCCGATGCACCTGAAGCGCA
>probe:Drosophila_2:1636580_at:455:617; Interrogation_Position=2719; Antisense; TGCAGCCGCGTGTCCTGGAACAGCA
>probe:Drosophila_2:1636580_at:458:471; Interrogation_Position=2794; Antisense; GTTAAGGGCAAGAAGTTCTCCTGCG
>probe:Drosophila_2:1636580_at:108:629; Interrogation_Position=2845; Antisense; TCCGACATGAGCTCCCTTAAGGATG
>probe:Drosophila_2:1636580_at:352:145; Interrogation_Position=2891; Antisense; ACTCCGGACTGAGCATCATATCGCT
>probe:Drosophila_2:1636580_at:325:37; Interrogation_Position=2905; Antisense; ATCATATCGCTTGAGTTGCCCTTGC

Paste this into a BLAST search page for me
CGGAGCACTCTGCAGTTCTGGAGAAATCGAGCGCGAACTAGATGACCAGCGGGCCAATCGAGAGATCCGGACACATTAGCGAGGAGTACCTGGCGCAGTTAGTTCGAGCGGGATCTGTCTCTACAAGCTGGAGGCGCGTAACACCAAGGCAAGGCGCTGAACATGATCACCGATCGATCACCGATCTGGCGAACAGCGACAAGTTGCCGATGCACCTGAAGCGCATGCAGCCGCGTGTCCTGGAACAGCAGTTAAGGGCAAGAAGTTCTCCTGCGTCCGACATGAGCTCCCTTAAGGATGACTCCGGACTGAGCATCATATCGCTATCATATCGCTTGAGTTGCCCTTGC

Full Affymetrix probeset data:

Annotations for 1636580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720