FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636582_at:

>probe:Drosophila_2:1636582_at:493:359; Interrogation_Position=466; Antisense; GCAACTTGTGTTTTGGCGGCTTATG
>probe:Drosophila_2:1636582_at:283:23; Interrogation_Position=510; Antisense; ATATCACGTTGTACCATTGGCTATC
>probe:Drosophila_2:1636582_at:482:571; Interrogation_Position=528; Antisense; GGCTATCTTCGAGTTCATTTACACA
>probe:Drosophila_2:1636582_at:717:659; Interrogation_Position=578; Antisense; TAACGCTACGGATTGCCAGACACAT
>probe:Drosophila_2:1636582_at:543:627; Interrogation_Position=605; Antisense; TGCCATTGGCCACCTTAATTCTGAT
>probe:Drosophila_2:1636582_at:507:709; Interrogation_Position=619; Antisense; TTAATTCTGATGACCCTTGCCCTTT
>probe:Drosophila_2:1636582_at:8:699; Interrogation_Position=647; Antisense; TTTACGCAATGCTTGTGGCCTACGA
>probe:Drosophila_2:1636582_at:137:579; Interrogation_Position=663; Antisense; GGCCTACGACACATTGGCGTTGATT
>probe:Drosophila_2:1636582_at:440:575; Interrogation_Position=678; Antisense; GGCGTTGATTGCCTTCGTGCAAATA
>probe:Drosophila_2:1636582_at:236:469; Interrogation_Position=705; Antisense; GTTCCTAGTGCGGAGTCAACGTTAT
>probe:Drosophila_2:1636582_at:229:401; Interrogation_Position=734; Antisense; GACTTTACGGTCCAGATCCTTTGAA
>probe:Drosophila_2:1636582_at:647:689; Interrogation_Position=798; Antisense; TATTAATCCGATCTCACAACAGCCA
>probe:Drosophila_2:1636582_at:238:695; Interrogation_Position=952; Antisense; TTTCAGCGGCAGGAGCTTTTGTCAA
>probe:Drosophila_2:1636582_at:569:183; Interrogation_Position=975; Antisense; AAAAGTTTTACTACGCAATGCCATC

Paste this into a BLAST search page for me
GCAACTTGTGTTTTGGCGGCTTATGATATCACGTTGTACCATTGGCTATCGGCTATCTTCGAGTTCATTTACACATAACGCTACGGATTGCCAGACACATTGCCATTGGCCACCTTAATTCTGATTTAATTCTGATGACCCTTGCCCTTTTTTACGCAATGCTTGTGGCCTACGAGGCCTACGACACATTGGCGTTGATTGGCGTTGATTGCCTTCGTGCAAATAGTTCCTAGTGCGGAGTCAACGTTATGACTTTACGGTCCAGATCCTTTGAATATTAATCCGATCTCACAACAGCCATTTCAGCGGCAGGAGCTTTTGTCAAAAAAGTTTTACTACGCAATGCCATC

Full Affymetrix probeset data:

Annotations for 1636582_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720