FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636583_at:

>probe:Drosophila_2:1636583_at:57:199; Interrogation_Position=1035; Antisense; AACGATGCCCTTTGCGGACCCGAAG
>probe:Drosophila_2:1636583_at:665:293; Interrogation_Position=1055; Antisense; CGAAGACGTCAATACCCTGGTGGAG
>probe:Drosophila_2:1636583_at:375:107; Interrogation_Position=1078; Antisense; AGAACTTCCCGCACCTGACGGAGGA
>probe:Drosophila_2:1636583_at:727:427; Interrogation_Position=1121; Antisense; GAGTTTCAACCACTTGGACTTCATC
>probe:Drosophila_2:1636583_at:129:557; Interrogation_Position=1136; Antisense; GGACTTCATCATCGCCAAGAACATG
>probe:Drosophila_2:1636583_at:7:121; Interrogation_Position=1165; Antisense; AGCTGGTCAACGATCCGATCATCGA
>probe:Drosophila_2:1636583_at:612:377; Interrogation_Position=1188; Antisense; GAACGCATTAACTCCTACGAAGGTC
>probe:Drosophila_2:1636583_at:57:373; Interrogation_Position=1206; Antisense; GAAGGTCGCTAGAAATCGGCCAATA
>probe:Drosophila_2:1636583_at:297:37; Interrogation_Position=1236; Antisense; ATCCGTAATGCACCGATTTTAACAC
>probe:Drosophila_2:1636583_at:112:663; Interrogation_Position=1255; Antisense; TAACACATAGTTTTCGGGCTACGTA
>probe:Drosophila_2:1636583_at:129:15; Interrogation_Position=1356; Antisense; ATTAGTATAGCCTTCCCATGGAAAA
>probe:Drosophila_2:1636583_at:358:671; Interrogation_Position=894; Antisense; TACCTGCAGCTATGGAAGTCCCTCA
>probe:Drosophila_2:1636583_at:603:601; Interrogation_Position=961; Antisense; TGTATGGCCAGGATCTGCCTCCAGA
>probe:Drosophila_2:1636583_at:285:627; Interrogation_Position=976; Antisense; TGCCTCCAGATTACGATCTCAGCAA

Paste this into a BLAST search page for me
AACGATGCCCTTTGCGGACCCGAAGCGAAGACGTCAATACCCTGGTGGAGAGAACTTCCCGCACCTGACGGAGGAGAGTTTCAACCACTTGGACTTCATCGGACTTCATCATCGCCAAGAACATGAGCTGGTCAACGATCCGATCATCGAGAACGCATTAACTCCTACGAAGGTCGAAGGTCGCTAGAAATCGGCCAATAATCCGTAATGCACCGATTTTAACACTAACACATAGTTTTCGGGCTACGTAATTAGTATAGCCTTCCCATGGAAAATACCTGCAGCTATGGAAGTCCCTCATGTATGGCCAGGATCTGCCTCCAGATGCCTCCAGATTACGATCTCAGCAA

Full Affymetrix probeset data:

Annotations for 1636583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720